ID: 1193668315

View in Genome Browser
Species Human (GRCh38)
Location X:84351602-84351624
Sequence AGGTGCAAACAAATGGAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 493
Summary {0: 1, 1: 0, 2: 5, 3: 47, 4: 440}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193668315_1193668319 -1 Left 1193668315 X:84351602-84351624 CCTTTTTCCATTTGTTTGCACCT 0: 1
1: 0
2: 5
3: 47
4: 440
Right 1193668319 X:84351624-84351646 TATTGGTGTTTCTTGATTGTTGG 0: 1
1: 0
2: 1
3: 25
4: 280
1193668315_1193668320 20 Left 1193668315 X:84351602-84351624 CCTTTTTCCATTTGTTTGCACCT 0: 1
1: 0
2: 5
3: 47
4: 440
Right 1193668320 X:84351645-84351667 GGCTTTTCCAGTATCTATTCTGG 0: 1
1: 0
2: 0
3: 16
4: 157
1193668315_1193668321 21 Left 1193668315 X:84351602-84351624 CCTTTTTCCATTTGTTTGCACCT 0: 1
1: 0
2: 5
3: 47
4: 440
Right 1193668321 X:84351646-84351668 GCTTTTCCAGTATCTATTCTGGG 0: 1
1: 0
2: 1
3: 36
4: 271
1193668315_1193668322 22 Left 1193668315 X:84351602-84351624 CCTTTTTCCATTTGTTTGCACCT 0: 1
1: 0
2: 5
3: 47
4: 440
Right 1193668322 X:84351647-84351669 CTTTTCCAGTATCTATTCTGGGG 0: 1
1: 0
2: 0
3: 17
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193668315 Original CRISPR AGGTGCAAACAAATGGAAAA AGG (reversed) Intronic
900723971 1:4202706-4202728 AGGTGGAGGCAAATGGATAATGG - Intergenic
901519918 1:9775611-9775633 AGGTGAACATAAAAGGAAAATGG - Intronic
904465306 1:30704169-30704191 AGGGTGAGACAAATGGAAAACGG - Intergenic
904676964 1:32204577-32204599 AGCTGCCAACAAAGAGAAAAAGG - Exonic
905248362 1:36630131-36630153 AGGTGCAACCATTTGGAACAAGG - Intergenic
905980061 1:42217205-42217227 AGCTACAAGCAATTGGAAAATGG + Intronic
906118755 1:43373431-43373453 ATGAGGAAAAAAATGGAAAAAGG + Intergenic
906973924 1:50548586-50548608 AGGTGGAAACACAGTGAAAAGGG - Intronic
907363659 1:53943043-53943065 TGGTGCTCACAAATGGAAAAAGG + Intronic
907944386 1:59121402-59121424 ATGTGCAAGGAAATGTAAAATGG - Intergenic
908917892 1:69153258-69153280 TGACACAAACAAATGGAAAAAGG - Intergenic
908960190 1:69688270-69688292 AGGTGAAGTCAATTGGAAAAGGG - Intronic
909509804 1:76439377-76439399 TGGTGTATACAAATGAAAAAAGG + Intronic
910266163 1:85340091-85340113 AGATGAAAATAAATGGAAAAGGG + Intronic
910541754 1:88367106-88367128 TGGTGCAAACAACTGTAAAAGGG - Intergenic
910665008 1:89715332-89715354 AGGTGTAAACAAGTTAAAAATGG - Exonic
911375809 1:97049764-97049786 AGGTGCAAACAAGCAGAAATTGG - Intergenic
912096657 1:106152872-106152894 AGGGACAAAAAGATGGAAAATGG + Intergenic
912221059 1:107675997-107676019 AGGATCCTACAAATGGAAAAAGG + Intronic
912613767 1:111076373-111076395 AGATGCAAAAAAATGATAAAGGG - Intergenic
912815942 1:112828651-112828673 AGGTGAAAACAAATAAAAATAGG + Intergenic
913387610 1:118276943-118276965 AGGAGGAAACAAAGGGAAAAAGG - Intergenic
915923747 1:159999676-159999698 ATGTGCATACAATTAGAAAAAGG + Intergenic
916140863 1:161696447-161696469 ATGTGCAAAAAAATGATAAAAGG + Intergenic
917150103 1:171933859-171933881 TATTGCAACCAAATGGAAAAAGG + Intronic
917207625 1:172594125-172594147 AGATGCAAAAAAATTGATAAAGG - Intronic
917621590 1:176801829-176801851 AGGGGAGAACAAATGGGAAAAGG - Intronic
917761255 1:178160963-178160985 AGAAGCAACCAGATGGAAAATGG - Intronic
918274654 1:182942235-182942257 AAGTGCAAACAAAAGGGAAAAGG - Intronic
918588477 1:186214741-186214763 GGGAGAAAATAAATGGAAAATGG + Intergenic
918673176 1:187246653-187246675 AGGTGCAGACAATTGGATCAGGG - Intergenic
918733332 1:188026494-188026516 AGTTGCAAACAAGAGCAAAATGG - Intergenic
919509088 1:198438398-198438420 AGGTTCATATAAATGGCAAAGGG - Intergenic
919601311 1:199626086-199626108 ATGTCCAAAAAAATGAAAAATGG + Intergenic
920028506 1:203019982-203020004 AGGTGAAAACACATGGAATGGGG + Intronic
920165209 1:204031055-204031077 GGGTGCAGGCAAAGGGAAAAGGG - Intergenic
921088615 1:211820645-211820667 AGAAACAAACAAATGAAAAACGG + Intronic
921295392 1:213696627-213696649 AGGTGTACTCAATTGGAAAAAGG - Intergenic
921304784 1:213784972-213784994 AAGTAAAAAAAAATGGAAAAAGG + Intergenic
921417649 1:214909174-214909196 AGGAGGAAAGAAATGCAAAAGGG + Intergenic
921805407 1:219448568-219448590 AGGTGTAGACAGATGGACAATGG - Intergenic
922673930 1:227539049-227539071 AGGTGAAAATAAATTGAAAATGG + Intergenic
924449036 1:244161079-244161101 AGGTAGGAAAAAATGGAAAATGG - Intergenic
924466788 1:244305430-244305452 AGGAGGAAAAAAAAGGAAAAAGG - Intergenic
924574435 1:245266812-245266834 AGGGGCACACAATTAGAAAATGG - Intronic
1063019853 10:2116968-2116990 AAGTGCAAACACACAGAAAAGGG - Intergenic
1064362120 10:14675481-14675503 AGGTGGAGACAAATGGAACCAGG - Intronic
1066108522 10:32176681-32176703 AGGTGTTAAAAAATGGAAGAGGG + Intergenic
1066556676 10:36622243-36622265 ATGTGCAGACACAGGGAAAAGGG - Intergenic
1067357927 10:45548460-45548482 AGGTGCAATTAACTGGAAAAAGG + Intronic
1067832528 10:49618482-49618504 AAGAGGAAACGAATGGAAAAGGG + Intronic
1068313064 10:55304273-55304295 AGGTTCAGACAAAAGCAAAAAGG - Intronic
1068421989 10:56806667-56806689 AAGTGCAAACAAATTGAACTTGG + Intergenic
1068479638 10:57574319-57574341 AAATGGAAACAAATAGAAAAAGG + Intergenic
1068559448 10:58497029-58497051 TGGTGAAAACAAATGGAATCTGG - Intergenic
1068844222 10:61653166-61653188 AAGAGCAAAAACATGGAAAAGGG + Intergenic
1070295698 10:75159524-75159546 ATGTGCAAGAAAATGGAAAAGGG - Intronic
1070473316 10:76806510-76806532 AAATGCAAACAAAAGAAAAAAGG - Intergenic
1070772899 10:79092651-79092673 AAGTGCAAAGAAATGTCAAATGG - Intronic
1071585499 10:86816609-86816631 CTCTGCAAACAAGTGGAAAAAGG - Intronic
1071683861 10:87734842-87734864 AGGTGAAAAAGAATGCAAAAAGG - Intronic
1071685734 10:87754110-87754132 AGGTTGAAACAAATGACAAATGG + Exonic
1072439389 10:95440294-95440316 GTATGCAAATAAATGGAAAAGGG + Intronic
1073017645 10:100414452-100414474 TGGAGCAAATAAATGGAAGATGG + Intergenic
1074995319 10:118752916-118752938 AGATGCAAATAAATGAAAAATGG - Intronic
1075011962 10:118879895-118879917 AGGAGCAAATAATTGCAAAATGG + Intergenic
1075493386 10:122894602-122894624 AAGTGCAAATAAAAGGGAAAAGG + Intergenic
1077652811 11:3989292-3989314 AAGTGCAAACAAAAGGGAAAAGG - Intronic
1077836017 11:5928957-5928979 AGGAACAGACAAAAGGAAAAAGG - Intronic
1078065212 11:8074237-8074259 AGGTTCAAACACCTGGAAGAAGG + Intronic
1079277067 11:19050624-19050646 AGGGGCAGAGAAATGGAAAAGGG + Intergenic
1079789853 11:24723045-24723067 ATGGGCAAACTAATGGAAAAAGG + Intronic
1080009559 11:27443985-27444007 AAGACCAAACAAAAGGAAAAAGG - Intronic
1080951609 11:37040135-37040157 AGTTACAAACAAATGGGAGAGGG - Intergenic
1081441982 11:43090839-43090861 GGCAGCAAACAAATGGAAATGGG + Intergenic
1083101131 11:60307209-60307231 AGGTGCAAAATGATGGAGAAGGG - Intronic
1083210203 11:61179481-61179503 AGGAGGATACAAATGGACAACGG - Intergenic
1083479523 11:62934579-62934601 AGGTGCAAACATCTGGAAACAGG - Intergenic
1083480419 11:62941181-62941203 AGCTGCAAACAAATTTAACAGGG + Intronic
1085090793 11:73711497-73711519 AGGTGCCCACAAAAGGAAAATGG - Intronic
1085432474 11:76465229-76465251 CAATGCAAACAAATGGAAAATGG - Intronic
1085587228 11:77720962-77720984 GTGGGCAAAAAAATGGAAAATGG - Intronic
1086167699 11:83798561-83798583 AGGAGTAACCAAATGGGAAAAGG + Intronic
1086831429 11:91570073-91570095 AGATTAGAACAAATGGAAAATGG - Intergenic
1086947313 11:92855817-92855839 AGCTGTAAACCAGTGGAAAATGG + Intronic
1087265987 11:96061749-96061771 AGGAGGAAAGAAAAGGAAAAAGG - Intronic
1087320410 11:96651308-96651330 TGGTGCAAATAAATAGAAGATGG + Intergenic
1087377588 11:97364377-97364399 AAGTGCTAACAAACAGAAAAAGG + Intergenic
1087542843 11:99542860-99542882 AGTTGCAAACAACTGGAAGCTGG + Intronic
1087674716 11:101147183-101147205 ATGTGTAAACAAAAAGAAAAGGG - Intergenic
1088211641 11:107463368-107463390 AGGTGCAATAAAATTGATAAAGG - Intergenic
1088600974 11:111474961-111474983 AGGCACAATCTAATGGAAAATGG - Intronic
1089622883 11:119731921-119731943 AGGCGCAAACAGAAGGCAAAAGG + Intergenic
1089878424 11:121748462-121748484 AGATCTAAACAAATGGAAAGAGG - Intergenic
1091613998 12:2035236-2035258 AGGTGCAAATGACAGGAAAACGG - Intronic
1092770586 12:11892839-11892861 GGGTGCAAACAGATGGACTATGG + Exonic
1093517041 12:20000158-20000180 AGGTGCAGAAAACTAGAAAATGG - Intergenic
1093704439 12:22259074-22259096 AGGAGGAAAGAAATGAAAAAGGG - Intronic
1094316588 12:29142730-29142752 AGGTTTAAACAAGTGGAGAAAGG - Intergenic
1095655320 12:44661837-44661859 AGAAGGAAAGAAATGGAAAAGGG - Intronic
1097068357 12:56337119-56337141 AGGTGGACACCAATGGAATAAGG - Intronic
1097471387 12:59997421-59997443 AAGTGCAAACAAATATAAAGAGG + Intergenic
1098723511 12:73931732-73931754 ATATTCAAACAAATAGAAAATGG - Intergenic
1099170345 12:79356311-79356333 GGGTGTAAACAAATGGCTAATGG - Intronic
1099906017 12:88771221-88771243 AGGTGCAAAAGCATAGAAAAAGG + Intergenic
1099941506 12:89194596-89194618 AGTTGCCAAAAACTGGAAAAGGG - Intergenic
1100455495 12:94747792-94747814 AGTTGCCAATAAATGGCAAAAGG - Intergenic
1101519409 12:105467735-105467757 AGGGGCAAGCAAAGGGACAATGG - Intergenic
1104166832 12:126239832-126239854 AGGTGAAAAGATATGGGAAATGG - Intergenic
1104365170 12:128170348-128170370 AGGACCAAGCAAATGGGAAAAGG + Intergenic
1105804514 13:23945385-23945407 AGGTGGATACAGATGTAAAACGG + Intergenic
1106678632 13:31987405-31987427 AGGTGAAAAGAAATGGAAAGTGG + Intergenic
1106679507 13:31995692-31995714 TAGTACAAACAAATGCAAAATGG - Intergenic
1106793075 13:33176033-33176055 AGGAGCAAAGGAATTGAAAAGGG - Intronic
1107580998 13:41785689-41785711 ACTTGTAAACAAAAGGAAAATGG - Intronic
1107962189 13:45568322-45568344 AAGTGAAAACAGATGGAAACTGG - Exonic
1108903206 13:55437816-55437838 AGGTGCAAACAAATTAGAAAAGG + Intergenic
1108983779 13:56556606-56556628 AGGTGCAAAGAAAGAGGAAAGGG + Intergenic
1109249122 13:59997153-59997175 GGGTGCAAACATATGGTAGAAGG - Intronic
1109322299 13:60825964-60825986 AAGTGCAAACAAAAGGGAAAAGG - Intergenic
1109620884 13:64903064-64903086 AGGGGAAAACATAAGGAAAAAGG + Intergenic
1110478699 13:75948385-75948407 AGTTACAAAGAAAAGGAAAAAGG - Intergenic
1110972220 13:81778992-81779014 AGAAGTGAACAAATGGAAAATGG - Intergenic
1111084404 13:83355470-83355492 CTTTGCAAACAAATGGCAAATGG - Intergenic
1111205243 13:84999440-84999462 TGGTATAAACAAATGTAAAAAGG + Intergenic
1111736524 13:92147157-92147179 AGGTGAAAGAAAATGAAAAAGGG + Intronic
1112167615 13:96936447-96936469 AAGTACAAATAAAAGGAAAAAGG - Intergenic
1112830742 13:103447152-103447174 AAGTGCCATCAAATGAAAAAGGG - Intergenic
1114258092 14:21019283-21019305 AGGTGGAAACCAAAGGAGAAAGG + Intronic
1114738402 14:25067557-25067579 AGGTGAAAACAGATGAGAAAAGG + Intergenic
1114940044 14:27597779-27597801 AGATGCAAAGAAATGAAAGAGGG - Intergenic
1115536570 14:34378871-34378893 AGGTGGTAACCAATGGGAAAAGG + Intronic
1115793446 14:36905875-36905897 AGTTATATACAAATGGAAAAAGG + Intronic
1115985749 14:39102788-39102810 AGGTGGAAAGATGTGGAAAACGG - Intronic
1116382936 14:44295002-44295024 AGGAGTAGAAAAATGGAAAATGG - Intergenic
1117279097 14:54220055-54220077 AGTTGCAGATAAATGGAACAAGG + Intergenic
1117405175 14:55395064-55395086 AAGTGCAAACAAAAGGGAAAAGG - Intronic
1117669009 14:58086857-58086879 AGGTGTAGACACATGGAAAGGGG + Intronic
1117991611 14:61439471-61439493 ACGTGCAAAATAATGTAAAAGGG + Intronic
1119210505 14:72828165-72828187 AGTAGAAAACAAATGGAGAAAGG - Intronic
1119738084 14:76996675-76996697 AGGAGCAAAAAAATATAAAAAGG + Intergenic
1121065988 14:90965453-90965475 AGGTGCAAAAGAAAGGAGAAAGG + Intronic
1121834548 14:97080080-97080102 AGAAGCACACACATGGAAAAGGG + Intergenic
1121921439 14:97885579-97885601 GGGTGTGGACAAATGGAAAATGG - Intergenic
1124141872 15:27084381-27084403 AGGTGCCTCCAAATGGGAAATGG + Intronic
1124186496 15:27534215-27534237 AGATGCAAAAAAATGGGCAATGG + Exonic
1126536859 15:49775779-49775801 AGAAGCAAACAAATTTAAAATGG + Intergenic
1127280713 15:57489427-57489449 AGGGGTAAAGAAATAGAAAATGG + Intronic
1127792787 15:62413105-62413127 AGGTAAAATCAAGTGGAAAAGGG + Intronic
1128351284 15:66891648-66891670 AGGTTTAAGCAAAGGGAAAAGGG - Intergenic
1129626424 15:77204944-77204966 AAGTTCAAAAAAAGGGAAAAGGG + Intronic
1130292755 15:82618670-82618692 AGCAGCAAACAAACAGAAAATGG + Intronic
1131472970 15:92711953-92711975 AAGCGCAAACAAAAGGGAAAAGG + Intronic
1131970498 15:97887886-97887908 AGATGCAAGCAAGTGGAAGATGG - Intergenic
1132459853 16:46809-46831 AGGTTCAAAAAAATGAATAAGGG + Exonic
1133307588 16:4820527-4820549 AGGTGCAAACAAAGGGGAGGAGG - Intronic
1133397019 16:5456027-5456049 ATGTGAAAAAAATTGGAAAATGG + Intergenic
1133617861 16:7495642-7495664 ACATGCAAAAAAATGGACAAAGG - Intronic
1133842378 16:9421444-9421466 AGGTCAAAACAAATGGGAGAGGG - Intergenic
1134825556 16:17281533-17281555 AAATTCAAACAAAAGGAAAAAGG + Intronic
1135548152 16:23379329-23379351 GGGGGCAAACATATGTAAAAAGG + Intronic
1135763237 16:25154418-25154440 AACTACAAACTAATGGAAAAAGG - Intronic
1135847906 16:25935379-25935401 AGGTTCAGACAAATGTATAATGG + Intronic
1136515499 16:30765893-30765915 AAGTGCTAATAAAGGGAAAAAGG - Intronic
1137330533 16:47490908-47490930 AGGTTCAAACAAGTGGCAGAAGG - Intronic
1138871162 16:60888552-60888574 AGGTCCAAACAAATAGACACTGG - Intergenic
1138931757 16:61666534-61666556 AGATGCAAACAAGAAGAAAAAGG + Intronic
1140161468 16:72499349-72499371 ATGTTCACAAAAATGGAAAAGGG - Intergenic
1140637934 16:76938596-76938618 AGGAACACACAAATGGACAATGG + Intergenic
1141166703 16:81665627-81665649 ACGTGAAAACAACTGAAAAAGGG + Intronic
1141978765 16:87536283-87536305 ATGTGCAAACAAATCAAGAAAGG + Intergenic
1144069675 17:11657796-11657818 AGGTGCCAAAAAATTCAAAAGGG - Intronic
1144406881 17:14960420-14960442 AAGATCAAACACATGGAAAAAGG - Intergenic
1144530988 17:16039177-16039199 AGGTGCAAACAAATAAAAAATGG + Intronic
1145215439 17:21048059-21048081 AGGTGCAGACACATGGAAAAAGG + Intergenic
1145395743 17:22492976-22492998 AGGAGAAAACAAAATGAAAATGG - Intergenic
1146858594 17:36276251-36276273 AGGTGAAATCAAAAGTAAAAAGG - Intronic
1147088915 17:38080327-38080349 AGGTGAAATCAAAAGTAAAAAGG - Intergenic
1147108293 17:38240198-38240220 AGGTGAAATCAAAAGTAAAAAGG + Intergenic
1147346090 17:39796475-39796497 AGGTGAAACCAAATTGCAAAAGG - Intronic
1147807892 17:43145101-43145123 AAGTGCAAAAAAAGGGAAAAGGG + Intergenic
1148034160 17:44645639-44645661 AGGTAGAAGCAAATGAAAAATGG + Intergenic
1148421102 17:47547659-47547681 AGGTGAAATCAAAAGTAAAAAGG - Intronic
1149083702 17:52688561-52688583 AGGTGCAAAAAAATGTAGCATGG - Intergenic
1150068337 17:62130675-62130697 AAATGCAAGCAACTGGAAAATGG + Intergenic
1150571841 17:66393621-66393643 ACGTGCACACACATGGAAGAAGG - Intronic
1151127445 17:71860204-71860226 AGTTTCAAGCAAATGGAAAATGG - Intergenic
1151914490 17:77107416-77107438 AGTTTCAAACTAATGAAAAATGG + Intronic
1152973667 18:191300-191322 AGATGCAAACAAATGAAAAAGGG + Intronic
1153092321 18:1361865-1361887 AGGTTGAAACAAATGACAAATGG + Intergenic
1154108567 18:11546718-11546740 GGGTGCCAATAAAAGGAAAATGG + Intergenic
1155197029 18:23485151-23485173 AAGTGCACACAAAAGGGAAAGGG + Intronic
1156266798 18:35496519-35496541 AGGTGTATACAAATGTAAAAGGG + Intronic
1156367740 18:36445516-36445538 AGGAGTAAACAAATTGTAAATGG + Intronic
1156707626 18:39902065-39902087 AGGTGGATACAAATAAAAAATGG + Intergenic
1157001936 18:43537194-43537216 ATGTACAAACAAATTGACAAAGG - Intergenic
1157942419 18:51943594-51943616 AAGTACACAAAAATGGAAAATGG - Intergenic
1158502804 18:58018924-58018946 AAGTGCAAACAAAAGGGAAAAGG - Intergenic
1158651445 18:59291211-59291233 AGCTGCAAACAATTCAAAAATGG - Intronic
1159097203 18:63917500-63917522 AAGTGAAAAAAAAAGGAAAATGG + Exonic
1159520925 18:69522265-69522287 AGTAGGAAACAAATGGCAAATGG + Intronic
1159890670 18:73950350-73950372 AAGTGCAAAATAATGAAAAAGGG - Intergenic
1162758674 19:12875213-12875235 AGGAGTAAATAAATGGAAATTGG - Exonic
1163254016 19:16143924-16143946 TGGTGACCACAAATGGAAAATGG + Intronic
1165561560 19:36684976-36684998 AGGGGAAAACAGATGTAAAAAGG + Intergenic
1165697075 19:37908635-37908657 AGGTACAAACAGAAGCAAAAAGG - Intronic
1167762264 19:51457300-51457322 AGCTGCAAATACAGGGAAAATGG + Intronic
925532564 2:4881045-4881067 AATTGTAAACAAATGGAACATGG - Intergenic
925647524 2:6052006-6052028 AGGTGGAATCAACTGGACAAAGG - Intergenic
926278190 2:11422179-11422201 AGGTGGAAACAAATTGTAAAAGG + Intergenic
927326635 2:21812755-21812777 AGGTGCCAACAGAGGGGAAATGG - Intergenic
927742211 2:25581745-25581767 AGCTCCAAAGAAAAGGAAAAAGG + Intronic
928494129 2:31814197-31814219 TGGTGAAAACTAATGGAACAAGG - Intergenic
929783032 2:44969958-44969980 AGGAGAAAAGAAAAGGAAAAAGG + Intergenic
930302457 2:49634051-49634073 AGGTGGAAACATTAGGAAAAGGG - Intergenic
930606688 2:53500232-53500254 AGGGGCAAAGAAAAGGAAAAAGG - Intergenic
930790520 2:55322372-55322394 AGGTAGGAACAAATAGAAAAAGG + Intronic
932411256 2:71549324-71549346 AAGCGTAAAGAAATGGAAAAGGG - Intronic
933042330 2:77485485-77485507 TGGTGCAAAGAAATGTATAATGG + Intronic
933984461 2:87579083-87579105 AGTTGCAAACAAAAAAAAAAAGG + Intergenic
934867653 2:97827393-97827415 ACGTGCAAACAAAAGGGAAAAGG + Intronic
934889937 2:98058573-98058595 GGGTGCCAATAAATGGAAAGAGG + Intergenic
935121468 2:100186802-100186824 AGGTACAAACAAAATGGAAAAGG - Intergenic
935214377 2:100964591-100964613 AGTGGCAAACATGTGGAAAATGG - Intronic
936140246 2:109933476-109933498 GGGGGCATACAAATGGAACATGG - Intergenic
936176936 2:110231421-110231443 GGGGGCATACAAATGGAACATGG - Intergenic
936204449 2:110438010-110438032 GGGGGCATACAAATGGAACATGG + Intronic
936380897 2:111985084-111985106 AGTGGCAAACAAAAGGCAAAGGG + Intronic
936913557 2:117616635-117616657 AGGGGAAAACCAATGGAATAGGG + Intergenic
937484298 2:122297969-122297991 AAGTGCAAAGAAATGAAAGAAGG + Intergenic
939133981 2:138272857-138272879 TTGTATAAACAAATGGAAAAAGG - Intergenic
939697632 2:145346236-145346258 AGGTAAATACAAATGGGAAATGG + Intergenic
939832201 2:147086418-147086440 AAGTACAAAAATATGGAAAAGGG - Intergenic
941507307 2:166362976-166362998 AGTTACAAGCAAATGAAAAATGG - Intronic
941974980 2:171393684-171393706 AGGTGGAAACAGATGCTAAAAGG + Intronic
942211838 2:173678715-173678737 AAGAGCAAATAAAAGGAAAAAGG + Intergenic
942296715 2:174524535-174524557 AGGTGCAAAAAAAAAAAAAAAGG - Intergenic
942468895 2:176239091-176239113 AGGTGGGAGCAAAGGGAAAATGG - Intergenic
942814887 2:180041255-180041277 AGATACAAATAAATGGGAAAAGG - Intergenic
943245718 2:185448514-185448536 AGGTGAAAACAAATTGAAGAGGG + Intergenic
943502852 2:188713287-188713309 ATTTGAAAAAAAATGGAAAAAGG - Intergenic
943888509 2:193254981-193255003 GGGTGCAAACAATTAGAATAAGG - Intergenic
945478026 2:210308814-210308836 ACATGCAAACAAATGCACAAAGG - Intronic
945661416 2:212689979-212690001 AGCAGGAAAAAAATGGAAAAAGG - Intergenic
946096651 2:217280437-217280459 AGCTGAAAACAAATGTAAAGAGG + Intergenic
946180252 2:217944415-217944437 AGGTGCAGAGAAATGGCCAAAGG + Intronic
946682580 2:222232642-222232664 AGGGCCATACAAATGGAATAAGG - Intronic
946980102 2:225203013-225203035 ATTTGAAAACAAATGGACAATGG - Intergenic
947090712 2:226508265-226508287 AGGAGCAAACAAATGGGCAAAGG - Intergenic
947141350 2:227021904-227021926 AGGTAGAAACAAATTGCAAAGGG + Intronic
947476251 2:230450100-230450122 AGGTCTAACCAAATGGAAACAGG + Intronic
948834084 2:240616185-240616207 AGAGGCAAACAGAAGGAAAAAGG - Intronic
949075741 2:242056652-242056674 TAGTGCATAAAAATGGAAAATGG + Intergenic
1169279779 20:4257120-4257142 AGGAGAAAGGAAATGGAAAATGG - Intergenic
1169504582 20:6194989-6195011 AGAAGCAATCCAATGGAAAATGG - Intergenic
1170231048 20:14046910-14046932 AAGCTCTAACAAATGGAAAATGG + Intronic
1170302179 20:14896498-14896520 TGCTGCAAACAAATAGACAAGGG - Intronic
1170591273 20:17773643-17773665 AGGTGGAGCCAAATGCAAAAAGG + Intergenic
1171155137 20:22865065-22865087 AGCTGCCAAGAAATGGAACAGGG + Intergenic
1171164509 20:22958157-22958179 AGGGGCACAGAAATGGTAAAGGG + Intergenic
1171362413 20:24597209-24597231 ATGTGCAGACAAATGTACAATGG - Intronic
1173305874 20:41848718-41848740 ATGTGGAAACAAATGGGACAGGG + Intergenic
1176876409 21:14134296-14134318 TGACACAAACAAATGGAAAATGG + Intronic
1177008262 21:15700387-15700409 GGTAGCAAAGAAATGGAAAATGG + Intergenic
1177028152 21:15948217-15948239 AGGAGATAACAAATGGATAAGGG + Intergenic
1177373189 21:20233577-20233599 AGCTGCAAACAAATCAAGAAAGG - Intergenic
1177922804 21:27173822-27173844 AGGGGCAAACTAATGTAAATTGG + Intergenic
1177961906 21:27677935-27677957 AGGTGGTTACAAATGGAAATGGG + Intergenic
1178102688 21:29286806-29286828 AGGTGCACAAAAATGGTAAAAGG + Intronic
1178332093 21:31706714-31706736 ATGTGCAAACAAAAGGGAAAGGG + Intronic
1178540727 21:33447290-33447312 AGGTGCAACTAAATCTAAAAAGG + Intronic
1179213293 21:39345233-39345255 AAGTGCAAACAAAAGGGAAAAGG - Exonic
1179536053 21:42053358-42053380 TGGTGCAACCATCTGGAAAAGGG - Intergenic
1182132701 22:27869053-27869075 AGCTAAAAACAAATGGAAACAGG + Intronic
1182582881 22:31325678-31325700 TGGTGCAATGAAGTGGAAAAGGG + Intergenic
949130330 3:492394-492416 AGGGGCAAACTGAAGGAAAATGG + Intergenic
949293072 3:2488015-2488037 AGGTACACACCAATGGAAAGAGG - Intronic
949421461 3:3870715-3870737 AGATGCCTACAAATGGCAAATGG - Intronic
949723780 3:7020421-7020443 ATGTTCAATCAAATGCAAAATGG + Intronic
949812330 3:8019494-8019516 AGGTTCAAACAAGTGGTGAAAGG - Intergenic
949994310 3:9604140-9604162 TGGTGCAAAAAAATAGTAAAAGG + Intergenic
950990343 3:17430493-17430515 AGGTGCAAAAAAATGGTAATAGG + Intronic
951144670 3:19213299-19213321 AGGTGCATATGGATGGAAAAGGG - Intronic
951856325 3:27201163-27201185 ATATGCAAAAAATTGGAAAAAGG - Intronic
952052414 3:29400628-29400650 AGCTGCAATCAATTGGGAAAAGG + Intronic
952336663 3:32409282-32409304 ACGATCAAACAAATGTAAAATGG - Intronic
952722310 3:36546075-36546097 AGGAGCAACAAACTGGAAAAGGG - Intronic
954845064 3:53548150-53548172 AGGTGCAAAGAGAAAGAAAAAGG - Intronic
957162717 3:76630893-76630915 AGGTGCAAAGAAGGGGAAAATGG + Intronic
957660484 3:83145265-83145287 AGGTGAAGACAAATGGAACGTGG - Intergenic
958114393 3:89196603-89196625 AGGTGAAATGATATGGAAAAAGG - Intronic
958123271 3:89321596-89321618 AAGTGCGAGCAAATAGAAAAAGG + Intronic
958426846 3:93988767-93988789 AAATGCAAACAAATGGGAAAAGG - Intronic
958756644 3:98257555-98257577 AGCAGAAAACAAATGAAAAATGG - Intergenic
959392442 3:105792887-105792909 AGGAGGAAACAAATTTAAAAAGG + Intronic
959829207 3:110840207-110840229 AGGTGAAAACATTTGGAAAGTGG + Intergenic
960397703 3:117157146-117157168 AGGTGTAAATAGATGGAGAAAGG + Intergenic
960535864 3:118813691-118813713 AGGGGCAGGCAAATGGAAATGGG - Intergenic
961573117 3:127814551-127814573 AGGTGCCAATAAATAGACAATGG + Intronic
961595264 3:128011031-128011053 CGGTGCAAAGAAAGGGAATAAGG + Intergenic
961662241 3:128475543-128475565 GGGTGCAAACAGAGGGAAGAAGG + Intergenic
962763149 3:138535881-138535903 AGGTGTGAATAAATAGAAAAGGG - Intronic
963244917 3:143048888-143048910 AAGTGAAAATAGATGGAAAAAGG + Intronic
963719299 3:148841799-148841821 TATTGCAAACAAAAGGAAAAGGG - Intronic
965780564 3:172281489-172281511 AGGTGGAATCAGGTGGAAAATGG + Intronic
965869169 3:173246121-173246143 AGGTGTAAGCAAGTTGAAAAGGG - Intergenic
966167961 3:177042230-177042252 AAGTGCAAAAAAATGGGGAAGGG + Intronic
966213054 3:177472458-177472480 AGGGAAAAACAAATGGCAAAAGG + Intergenic
966925324 3:184640815-184640837 GGGTGAAAACAAATGCCAAATGG - Intronic
967306024 3:188060403-188060425 AGGTGCAGACAAAGGCAGAAAGG - Intergenic
968066195 3:195761160-195761182 AGGTGGACACAGATGGAATAAGG - Intronic
968581124 4:1395817-1395839 AGGTGCAGAGAAATATAAAAGGG - Exonic
970837049 4:20421829-20421851 AGGTGCTGTCAAATGGAGAAAGG - Intronic
971170175 4:24225692-24225714 GGGTCTGAACAAATGGAAAATGG + Intergenic
971515394 4:27479970-27479992 ACCTGCAAACATACGGAAAACGG - Intergenic
971909348 4:32775313-32775335 AAGAGGAAATAAATGGAAAATGG + Intergenic
971933220 4:33113410-33113432 AGGTGCACACCAATGGTAGATGG + Intergenic
972561396 4:40232030-40232052 AAGTGCCAACAAAGGGAAAAAGG - Intronic
972703865 4:41521069-41521091 AGGTGGGAATAAAAGGAAAATGG - Intronic
973116047 4:46460766-46460788 AGGTGCCAACAAATACAATAGGG + Intronic
973180144 4:47257011-47257033 AGGTGGAAAAAAATGGAGAGTGG - Intronic
973902176 4:55487021-55487043 AGAGCCAAAGAAATGGAAAATGG - Intronic
974088308 4:57284326-57284348 AGCTGCATACAAAAGAAAAAGGG - Intergenic
974486345 4:62510617-62510639 AGGTGCAAACAAAAGGGAAAAGG + Intergenic
974583749 4:63841799-63841821 TGTTGCAAACAAATTGAAACAGG + Intergenic
975981608 4:80167003-80167025 AGGTGCATACAGATTGAAGATGG + Intergenic
976127242 4:81846916-81846938 AGGTGAATCCAAATGAAAAATGG + Intronic
976442857 4:85096158-85096180 AGGGGGAAAGAAATGGAAGAAGG - Intergenic
976858603 4:89634050-89634072 AGGTGCAAAAAAATAGGAGAAGG + Intergenic
976862745 4:89686037-89686059 AGTTGAAAATCAATGGAAAATGG + Intergenic
976911816 4:90316336-90316358 TGATGCAAACAATTGAAAAATGG - Intronic
976940337 4:90693534-90693556 AGGTGTGAACAAATGATAAAAGG + Intronic
977012942 4:91658209-91658231 AGGTGTACACTAATAGAAAAAGG - Intergenic
977410603 4:96657250-96657272 AAGGGCATACAAATAGAAAAGGG + Intergenic
977640482 4:99353074-99353096 TAGTGCAGACAAAGGGAAAACGG - Intergenic
978639299 4:110850586-110850608 AGCAGCAAACAAATAAAAAAGGG - Intergenic
978870997 4:113577827-113577849 ATGTCCAAACACATGGAACATGG - Intronic
978880405 4:113695584-113695606 AGCTGCTGACAAATTGAAAATGG - Intronic
979885091 4:126017257-126017279 TGTTGCAATCAAATGGAACAAGG - Intergenic
979922664 4:126520464-126520486 AGATACAATCAAATAGAAAAAGG + Intergenic
980705404 4:136486478-136486500 AGAAGCACAAAAATGGAAAAGGG - Intergenic
982058869 4:151582689-151582711 AAGTGCAAATAAGTGAAAAATGG + Intronic
982986892 4:162221191-162221213 AGGATGAAACAAATGGAACAGGG + Intergenic
983562836 4:169118138-169118160 AGGAGCAAAGATATGGAAATGGG - Intronic
983698373 4:170560855-170560877 AAGTACAAATAAATAGAAAATGG + Intergenic
984454108 4:179943498-179943520 AGGAGGAGAGAAATGGAAAAAGG + Intergenic
986475301 5:8124038-8124060 TGGAGCAAAAAAATGTAAAACGG + Intergenic
986798950 5:11240006-11240028 AGGTGCTAACGAATGAAGAAAGG + Intronic
988148763 5:27347743-27347765 AAGTTCAACAAAATGGAAAATGG + Intergenic
989149219 5:38282289-38282311 AGGTGCAAACAAAACAAATAAGG + Intronic
989400551 5:41003467-41003489 TGGAGCAAAGAAATGGGAAAAGG + Intronic
989826384 5:45861741-45861763 AGGTGAACACATATGGAAGAGGG + Intergenic
990368281 5:55091854-55091876 ACGTGCAAACAAATGAACTAGGG - Intergenic
990376516 5:55176265-55176287 ACGTGCAAATACATTGAAAAGGG - Intergenic
990446821 5:55901008-55901030 AGGTGTAAGCAAATAGAGAAAGG - Intronic
990499549 5:56381932-56381954 AAGTGCAAACAAAAGGGAAAAGG + Intergenic
990656419 5:57961747-57961769 ATATGCAAAAAAATGGAAACTGG - Intergenic
991908602 5:71537673-71537695 AAGTGCAAACAAGAGAAAAACGG - Intronic
992019858 5:72611924-72611946 TGCTGCTCACAAATGGAAAATGG + Intergenic
993238787 5:85351997-85352019 AAGGGCAAATTAATGGAAAAAGG - Intergenic
994723664 5:103409592-103409614 AGTAGAAAACAGATGGAAAAAGG + Intergenic
994782925 5:104116177-104116199 AAGGGGAAACAAAAGGAAAATGG + Intergenic
995293975 5:110496954-110496976 TGGTGGAAACAAACAGAAAAAGG + Intronic
997126301 5:131230445-131230467 AGGGGCAAAAAAGTGAAAAATGG + Intergenic
997966568 5:138361544-138361566 ATGTGCAAAGAATTGGACAAGGG + Intronic
998119672 5:139565542-139565564 AGATGCAGCCAACTGGAAAAGGG - Intronic
998947205 5:147352586-147352608 AGGAGCAACCACAGGGAAAAGGG - Intronic
1000251255 5:159497701-159497723 AGGAGAAAACAAGTGGAAATGGG - Intergenic
1000500598 5:162044437-162044459 AAGTGAAAACAAAAGGAAATTGG - Intergenic
1000909837 5:167008669-167008691 AAGTCCAAACAAATGACAAATGG - Intergenic
1000968734 5:167690654-167690676 AGGTGATAGAAAATGGAAAATGG - Intronic
1001182712 5:169535680-169535702 AGGTGCAATTAAATGGTAATAGG + Intergenic
1001323467 5:170701791-170701813 AGTTGCCAACAACAGGAAAAAGG - Intronic
1003443661 6:6165794-6165816 AGGGAGAAACAAATGCAAAATGG - Intronic
1004406020 6:15334562-15334584 AGGAGCAAGCACATGGTAAAAGG - Intronic
1004636561 6:17474085-17474107 AGGGGCTAAAAAATGGAAAATGG - Intronic
1005446382 6:25927929-25927951 AAGTGAAATCAAATAGAAAATGG - Intronic
1005640841 6:27794589-27794611 ATGTGCAACCAAATGGAGACAGG + Intergenic
1006624658 6:35388792-35388814 AGGTGCAAACATGTGGCAGAGGG + Intronic
1006776774 6:36599269-36599291 TGGAGCCAAGAAATGGAAAAAGG - Intronic
1007037290 6:38687829-38687851 AGGTACATACCAATGGTAAAGGG - Intronic
1007243748 6:40445172-40445194 AGGTGCAATCCAAGGGAAGAGGG + Intronic
1007255506 6:40525381-40525403 AGGTGCAAATGAATGTAAATTGG - Intronic
1008072130 6:47108293-47108315 AGATGAAAACAAATGATAAAGGG + Intergenic
1008794839 6:55290618-55290640 ACATGCAAACAAATGAAACATGG - Intergenic
1009055143 6:58326242-58326264 ATATGCAAAAAACTGGAAAATGG - Intergenic
1009236019 6:61124333-61124355 ATATGCAAAAAACTGGAAAATGG + Intergenic
1009276071 6:61681999-61682021 AGGTGCAGACAAAGGAAAGAAGG + Intronic
1009405682 6:63309455-63309477 AGGTGACAAAAGATGGAAAATGG - Intronic
1010061004 6:71623309-71623331 AGGTGCAAACAATAAGAAAATGG - Intergenic
1010258237 6:73785379-73785401 AGATTCAAAAAAATGAAAAATGG - Exonic
1010800592 6:80170039-80170061 AGCTGAAAAAAAAAGGAAAAAGG - Intronic
1011113474 6:83864158-83864180 AGGTACCTAAAAATGGAAAAAGG - Exonic
1011724266 6:90193148-90193170 AGGTGCAGACAATTGCAAGATGG + Intronic
1012610305 6:101210125-101210147 ACTTTCAAACATATGGAAAATGG + Intergenic
1013062579 6:106650542-106650564 AGGGGTAAACAAATCAAAAAGGG - Intronic
1013210109 6:107979066-107979088 AAGTGCAAAAAAAGAGAAAAGGG - Intergenic
1014970209 6:127805010-127805032 AGGTGCACACAAAATTAAAAAGG - Intronic
1015833119 6:137390564-137390586 AGGTGCAAACATATTGAGATGGG + Intergenic
1015891030 6:137969892-137969914 AGGAGCAAAGAAAGAGAAAAGGG + Intergenic
1016678802 6:146804109-146804131 AGATGACAACAAATGAAAAAAGG + Intronic
1018336970 6:162802835-162802857 AGTAGCAAGAAAATGGAAAAGGG - Intronic
1018669675 6:166168095-166168117 AGGTGCAAACATTTGGAGAAGGG - Intronic
1018724532 6:166600792-166600814 AAGTGAATAGAAATGGAAAATGG + Intronic
1020883103 7:13787530-13787552 AAGTACAAACAAAAGGAAAATGG + Intergenic
1020970353 7:14930487-14930509 AGCTGAAAACAAATTCAAAAAGG - Intronic
1021123961 7:16828743-16828765 AGATGCAAGAAAAGGGAAAAAGG + Intronic
1022252452 7:28621840-28621862 AGGTGAAAAGAAAATGAAAATGG + Intronic
1022645416 7:32224817-32224839 AGGGAAAAACAATTGGAAAATGG + Intronic
1023975784 7:45028758-45028780 TGGTGCCTACCAATGGAAAAAGG - Intronic
1024156865 7:46634790-46634812 AAGTGCAAACAAAAGGGAAACGG + Intergenic
1024503216 7:50135877-50135899 ATGAGAAAACAAATGGAAATTGG + Intronic
1024627501 7:51220542-51220564 AGGTGAAAACAAAGGCAAAGGGG - Intronic
1024661929 7:51503924-51503946 ACTTGAAAAAAAATGGAAAAGGG - Intergenic
1024857966 7:53803654-53803676 AGTTGAAAACAAAGGGAAAAAGG - Intergenic
1025109483 7:56201945-56201967 AGGTGAAAAAAAATAGAAAGTGG + Intergenic
1026031929 7:66801784-66801806 AGGTGGAGCCAAATGGGAAAGGG - Intronic
1029383204 7:100226662-100226684 AGCTGCACAGAAATGGGAAAAGG + Intronic
1029974781 7:104822771-104822793 AGGGGCAAACACAGGGAGAAAGG + Intronic
1030429641 7:109427854-109427876 AAGTGCTAAAAAAAGGAAAAAGG + Intergenic
1031378024 7:121051050-121051072 ATGTGCAAACAAAAGGGAAAAGG + Intronic
1031579691 7:123456829-123456851 AGTTGGAAGCAAATGAAAAATGG + Intronic
1031722852 7:125199013-125199035 GGGTGAAGAGAAATGGAAAAGGG - Intergenic
1031772939 7:125868721-125868743 AGATGCAAAGTTATGGAAAATGG + Intergenic
1033280340 7:140001979-140002001 GGATGCAAACAAGTGGATAAGGG - Intronic
1033602536 7:142898584-142898606 AGGTGCAAGCAAAATGAAGAAGG + Intergenic
1034696136 7:153055629-153055651 AAGTGCAGATAAATGGAGAAGGG - Intergenic
1036796623 8:11760778-11760800 AGGTGAAGACAAATGGATAAAGG - Intergenic
1037989579 8:23311305-23311327 AGGTGCACACAGATGGCACATGG + Intronic
1037992118 8:23328491-23328513 AGGTGCTCAAAAATGGAGAATGG - Exonic
1038379403 8:27078669-27078691 AGGAAAAAACAAATGGGAAAGGG + Intergenic
1039139613 8:34371729-34371751 GGGTAAAAACAAATGTAAAACGG + Intergenic
1039348213 8:36731692-36731714 GGGTGCAAACACATGGACACAGG + Intergenic
1039407712 8:37327230-37327252 AGTTGTAAACAGATGGAACAAGG - Intergenic
1039679762 8:39719178-39719200 ACATGCAAATATATGGAAAATGG + Intronic
1039789857 8:40866673-40866695 ATGTGCAACCAAATGCAAGAGGG + Intronic
1040437592 8:47407392-47407414 AGGAGCAAAGAAATGTAAAGTGG - Intronic
1041105746 8:54442500-54442522 TGGTGGAAACAAAAGGAAGATGG + Intergenic
1041824820 8:62082702-62082724 AGGCACAAACAAATTGACAATGG + Intergenic
1042023954 8:64402714-64402736 AGATGCAAAAAAATGATAAAGGG - Intergenic
1042546335 8:69954767-69954789 AGGTACAAGAAAATGTAAAAAGG + Intergenic
1042555294 8:70029200-70029222 AAGCACAAACAAGTGGAAAATGG - Intergenic
1042974760 8:74455639-74455661 AGGAGAAAAAAAATGAAAAATGG - Intronic
1043110457 8:76173239-76173261 ATATCCCAACAAATGGAAAACGG + Intergenic
1043184841 8:77134850-77134872 AGGTTAAAACAAAAGAAAAAAGG + Intergenic
1043326062 8:79053044-79053066 AAGAGAAAAAAAATGGAAAAAGG - Intergenic
1043908482 8:85833647-85833669 AGGGGCAAAAAAATGGGAGAGGG - Intergenic
1045156082 8:99473852-99473874 AGCAGCAAACAACCGGAAAATGG + Intronic
1045509402 8:102802764-102802786 ACAGGCAAACAAAGGGAAAATGG + Intergenic
1046218312 8:111179400-111179422 AGTTGCAAAAAAATATAAAAGGG + Intergenic
1046256857 8:111710868-111710890 AGGACCAAACAAATAGAGAAAGG + Intergenic
1046477361 8:114763746-114763768 AGGTGCAAAAATATGCAACAAGG - Intergenic
1046640705 8:116727320-116727342 AAGTGCAAACAAAGGGAAAAAGG + Intronic
1048199703 8:132361617-132361639 AGGTTAAAAGAAATGTAAAAGGG + Intronic
1050262846 9:3859304-3859326 AGGTGCAGACACTTAGAAAATGG - Intronic
1052359008 9:27534339-27534361 AGTACCAAACAAACGGAAAACGG - Intergenic
1052448966 9:28601639-28601661 AGGTGCTAACGAATGTGAAATGG - Intronic
1052560740 9:30079682-30079704 AGGGGCAGGCAAATGGAGAATGG - Intergenic
1053244910 9:36526914-36526936 AAGTGCAAACAAAAAGAAAGCGG + Intergenic
1056842433 9:90009372-90009394 AGTGGCAAACAGATGGAAACTGG + Intergenic
1057901184 9:98950180-98950202 AGGTGCAAAGAAGTAGAAACAGG - Intronic
1057993005 9:99792683-99792705 AGCAGCAAGCAATTGGAAAATGG - Intergenic
1058078403 9:100674225-100674247 GGGTGAAAACAGATGGAAAGGGG + Intergenic
1058713111 9:107698216-107698238 AGGTGGAAAGAAATGGAGCAGGG + Intergenic
1061464554 9:130767189-130767211 AGCTGCAAAGAAATGAAAAGGGG - Intronic
1061830456 9:133289894-133289916 AGGTTTAAACAAAGTGAAAAGGG - Intergenic
1062215239 9:135385559-135385581 AGGAGCAAACAAATGGAACGAGG - Intergenic
1203344901 Un_KI270442v1:27001-27023 AAGTGGAATCAAATGGAATACGG + Intergenic
1186711926 X:12207009-12207031 AAATGCAAACCAATTGAAAAGGG - Intronic
1187747805 X:22428801-22428823 ATGTGCACAGAAATGAAAAAGGG - Intergenic
1188563491 X:31497465-31497487 AGGTGCACACAAATAAAGAAGGG - Intronic
1188741904 X:33794234-33794256 AGGTGGAAAGAAATGAAAAGAGG - Intergenic
1189507025 X:41622181-41622203 AGGTCCAAATAAACTGAAAATGG + Intronic
1189843151 X:45103960-45103982 AGGTGTAAACACATAGAAGATGG - Intronic
1190443419 X:50498496-50498518 ACGTACCTACAAATGGAAAAAGG - Intergenic
1190549196 X:51561583-51561605 AGGTTCAAACAAGTGGAGGAAGG - Intergenic
1191772862 X:64781688-64781710 AGATGCAAAAAAACAGAAAAGGG - Intergenic
1191959412 X:66683790-66683812 AGGTGCATACAAAACCAAAATGG - Intergenic
1192034828 X:67550745-67550767 AGCTGCAGACAAAGAGAAAATGG - Intronic
1192217639 X:69174262-69174284 AAGTGCAAACAAAACGGAAAAGG + Intergenic
1192656223 X:72997994-72998016 TGGTGCAAACAAAAGGAGATGGG - Intergenic
1192665897 X:73085007-73085029 TGGTGCAAACAAAAGGAGATGGG + Intergenic
1192947972 X:75986204-75986226 AGCTTCAAACAAGTAGAAAATGG - Intergenic
1193186485 X:78519712-78519734 TAGTGCAAACAAAAGAAAAAAGG - Intergenic
1193668315 X:84351602-84351624 AGGTGCAAACAAATGGAAAAAGG - Intronic
1194127892 X:90042331-90042353 AGGGGCATACCACTGGAAAAGGG - Intergenic
1194530330 X:95039953-95039975 AGATGAAAATAAATGTAAAATGG - Intergenic
1196800026 X:119534267-119534289 AGATCTAAACAAATGGAAAGTGG + Intergenic
1196888521 X:120270258-120270280 ACGTGCACACAAATAGAAACAGG - Intronic
1198008307 X:132522409-132522431 AAGTGCAAACAAAAGGGAAAAGG - Intergenic
1198320570 X:135515448-135515470 AGGTGGAAACAAATGGTCCAAGG + Intergenic
1199987486 X:152963088-152963110 AGGTGCAAACAAGTGGTCAGTGG + Intronic
1200285364 X:154817234-154817256 AAGTGCAAACAAAAGGGAAAAGG - Intronic