ID: 1193669136

View in Genome Browser
Species Human (GRCh38)
Location X:84362344-84362366
Sequence ATAAGGCATCAGGAAAAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 246}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193669131_1193669136 28 Left 1193669131 X:84362293-84362315 CCCTAGGAAGTAAGTTAGAAACA 0: 1
1: 0
2: 1
3: 27
4: 225
Right 1193669136 X:84362344-84362366 ATAAGGCATCAGGAAAAGCTAGG 0: 1
1: 0
2: 2
3: 14
4: 246
1193669132_1193669136 27 Left 1193669132 X:84362294-84362316 CCTAGGAAGTAAGTTAGAAACAT 0: 1
1: 0
2: 0
3: 23
4: 242
Right 1193669136 X:84362344-84362366 ATAAGGCATCAGGAAAAGCTAGG 0: 1
1: 0
2: 2
3: 14
4: 246
1193669134_1193669136 -9 Left 1193669134 X:84362330-84362352 CCTCTACTTTGCTGATAAGGCAT 0: 1
1: 0
2: 0
3: 5
4: 131
Right 1193669136 X:84362344-84362366 ATAAGGCATCAGGAAAAGCTAGG 0: 1
1: 0
2: 2
3: 14
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193669136 Original CRISPR ATAAGGCATCAGGAAAAGCT AGG Intronic
900826613 1:4932178-4932200 ATGAACCATCATGAAAAGCTTGG + Intergenic
902470491 1:16645161-16645183 ATAAGGCAGCAGCAAAAGGGTGG + Intergenic
902716426 1:18275944-18275966 ATAAGGCATGAGGCAACACTGGG - Intronic
903337895 1:22636978-22637000 ATAAGAAACCAGGAAAAGCCTGG + Intronic
903823136 1:26118889-26118911 AGAAGACATCAGGAAAAACATGG - Intronic
904544893 1:31261635-31261657 GTAAGGTATCATGAAAAGCAAGG + Intronic
904729967 1:32582814-32582836 ATAAGGACTCAGCAAAAGCTGGG + Intronic
907317202 1:53580037-53580059 ATAAGGGATCAGGTAAGGCCTGG + Intronic
907363890 1:53944782-53944804 ATAAGGCATCAGGGAATACCAGG - Intronic
908755275 1:67464032-67464054 AGAAGTCATCAGAAAAGGCTGGG - Intergenic
910287336 1:85570255-85570277 ATCAGGCATCAGGAGAAGAAAGG - Intronic
911207431 1:95106037-95106059 CTAAGCCATCAGGAAGACCTGGG - Intergenic
911518441 1:98898350-98898372 ACATTGCATCAGGAAAAGATAGG + Intronic
913032929 1:114930033-114930055 ATAAGATATCTGGAAAAGCCCGG + Intronic
916210141 1:162353705-162353727 ATCAGTGATCAGGAGAAGCTGGG - Intronic
916632327 1:166629801-166629823 ACAAGGCAACAGGAAAGGCTTGG + Intergenic
916898171 1:169188909-169188931 ATTAGGTATCAGGAAAAGTTGGG + Intronic
917598674 1:176554120-176554142 ATAAGGAAACAGGACATGCTGGG + Intronic
918152514 1:181810074-181810096 ATAAGGCATTAGGTAGACCTGGG + Intergenic
920259938 1:204682385-204682407 ATAAGGCCCCATGAAAAGTTAGG + Intronic
920391150 1:205603167-205603189 ATAAGGAATAAGGAAAAGGCAGG + Intronic
921294935 1:213692753-213692775 ATAAGGTCTCAGGAGGAGCTGGG - Intergenic
923928294 1:238661324-238661346 ATAAAGCATCAAGGAATGCTGGG + Intergenic
1063867038 10:10376365-10376387 TGAAGGCATCAGGAAAATTTTGG + Intergenic
1064444689 10:15382963-15382985 ATAAGTCAGATGGAAAAGCTCGG + Intergenic
1064629420 10:17294689-17294711 ATAAGGCAGGAGGGAAGGCTTGG - Intergenic
1068200513 10:53778234-53778256 AAAATGCATCAGGAAAAGGAAGG - Intergenic
1069768334 10:70880691-70880713 AAAAGCCAAAAGGAAAAGCTGGG - Exonic
1070409612 10:76127658-76127680 ATAAGGCAGTTGTAAAAGCTTGG + Intronic
1070509529 10:77147743-77147765 ATCAGGCAGGAGGAAAAGTTGGG - Intronic
1070828298 10:79403846-79403868 AAAAGGCCTCAGGAAAACCCTGG + Intronic
1071513431 10:86281701-86281723 ATTGGGCATCAGGATCAGCTGGG + Intronic
1072237331 10:93464752-93464774 AAATGGCCTCAGGAAAAGTTAGG + Intronic
1072742987 10:97921424-97921446 ATGAGGCAACAGGCAAAGCCAGG - Intronic
1072976384 10:100062522-100062544 ATAAGGCATTTGGAAATGCCTGG - Intronic
1073193257 10:101667421-101667443 TTAAGTCATCAGGAGAGGCTTGG - Intronic
1077988710 11:7381995-7382017 AAAAGGCTTCAGAAAAGGCTTGG - Intronic
1078351337 11:10596788-10596810 ATAATCAATCAGGATAAGCTAGG + Intronic
1080610897 11:33902614-33902636 ATAAGGCATCAGGAAAAACCTGG - Intergenic
1081410037 11:42747041-42747063 ATGAGGCATCAGCTAAAGTTAGG + Intergenic
1083873290 11:65505499-65505521 AACAGGCTTCTGGAAAAGCTAGG - Intergenic
1085220533 11:74870401-74870423 AAAATGCAATAGGAAAAGCTTGG - Intronic
1085394212 11:76198524-76198546 TCCTGGCATCAGGAAAAGCTTGG - Intronic
1086481911 11:87249665-87249687 ATAATTCATCATGAAAAACTGGG - Intronic
1086863925 11:91957310-91957332 ATAATACATCAGGGAATGCTTGG - Intergenic
1089632059 11:119789991-119790013 ATATGCCATCAGCAAAAGCAAGG - Intergenic
1090095299 11:123736989-123737011 AGATGGCATAAGGAAAATCTTGG + Intronic
1090158094 11:124463133-124463155 ATAAGTCTTCTGGAAAAGTTAGG - Intergenic
1090479118 11:127052451-127052473 ATAAGGCACCATGGAAAACTGGG + Intergenic
1090539785 11:127688537-127688559 ATAGGGCAGAAGGAAATGCTGGG - Intergenic
1090922236 11:131216469-131216491 ATAGCACATCAGGAAAAGCATGG - Intergenic
1091504498 12:1053322-1053344 TTAATGCATAACGAAAAGCTAGG - Intronic
1092488407 12:8922694-8922716 ATTAGGCATCAGGATGAGTTGGG - Exonic
1092630177 12:10368379-10368401 ATAAGGAATCAGGAACACCAAGG - Intergenic
1095499184 12:42817801-42817823 ATGAGGTATAAGGAAAAGCAGGG - Intergenic
1096946563 12:55414197-55414219 ATTAGGCATCAGGATGAGTTGGG + Intergenic
1097276993 12:57820485-57820507 ATGAGGCCTCAGGAACAGGTAGG + Exonic
1097360891 12:58656599-58656621 ATCAGGCACCAGGAGAAGCCAGG + Intronic
1097569148 12:61309361-61309383 ATAAGAAATCAGGAAAAATTTGG - Intergenic
1098361501 12:69658750-69658772 ATAAGGCAGCAGGAAAGTTTAGG + Intronic
1099590802 12:84586830-84586852 ATAAGGCATGAGAGAAAGTTGGG + Intergenic
1101525552 12:105525421-105525443 ATAAGGCATGAGGAAAGATTTGG - Intergenic
1103734538 12:123050939-123050961 AAAAGGCATCAGAGATAGCTGGG + Intronic
1104710073 12:130979459-130979481 ATAAGGCATCACAGAAAGCATGG + Intronic
1105630932 13:22166851-22166873 ACAAGGCATCATGAAAACTTGGG + Intergenic
1107196741 13:37661545-37661567 ATATGGCAACAGGAACAGATGGG + Intronic
1109217114 13:59602677-59602699 ATAAAGCAACAGGGTAAGCTGGG + Intergenic
1109374501 13:61473654-61473676 ATATGGCTTCAGAAAAAACTTGG + Intergenic
1110618051 13:77563266-77563288 GGAAGGAAACAGGAAAAGCTGGG - Intronic
1112041262 13:95551027-95551049 ATGATACATCAGGACAAGCTGGG + Intronic
1113296300 13:108962821-108962843 ATGAGGTAGCAGGAAAAGGTTGG - Intronic
1114453676 14:22842273-22842295 ATGAGGTAGCAGGAAGAGCTGGG + Intronic
1115128720 14:30027023-30027045 AGAAGGTATCAGCAAAAGTTTGG - Intronic
1115720169 14:36152292-36152314 AAAAGACATCAAGAAAAGCCAGG + Intergenic
1115829648 14:37322314-37322336 ATAGGGCATGAGGAAACTCTGGG - Intronic
1115866351 14:37751480-37751502 AGGAGGCAGCTGGAAAAGCTGGG - Intronic
1119959298 14:78836308-78836330 TAAAGGCAGCAGCAAAAGCTGGG - Intronic
1120098920 14:80421802-80421824 AAAAGGCATTAGGAAAAAATTGG + Intergenic
1120378190 14:83736537-83736559 TTAGGGCATCTGGAAAAGTTAGG + Intergenic
1120468793 14:84896305-84896327 ATAAGGTAACAGGAAAAATTTGG - Intergenic
1121057107 14:90865695-90865717 AGTGGGCAGCAGGAAAAGCTGGG + Exonic
1121729358 14:96175643-96175665 ATCAGGCAACTGGAAATGCTTGG + Intergenic
1121777799 14:96602200-96602222 ATTAGGTAACAGGAAAACCTGGG - Intergenic
1121895267 14:97640886-97640908 TAAAGGCTTCAGGAAAAGATAGG - Intergenic
1121903833 14:97721701-97721723 TTAAGGCAGCAGGAAATGCTAGG + Intergenic
1121912738 14:97806738-97806760 TTAAGGCATCTGGAGATGCTGGG + Intergenic
1125375724 15:39026743-39026765 ATAAACCATCAGAAGAAGCTAGG - Intergenic
1125715418 15:41817229-41817251 ATAAGGAGACAGGAAAACCTGGG + Intronic
1127450793 15:59114494-59114516 GCAAGGCATCAGAAAAAGCTTGG - Exonic
1128886120 15:71289731-71289753 AGAAGGCATCAGGTGAGGCTAGG - Intronic
1129181314 15:73878836-73878858 AGAAGGGAACAGGCAAAGCTGGG - Intronic
1129389644 15:75214150-75214172 ATGAGGCCTCAGGACAAGCAGGG - Intergenic
1130118344 15:81025004-81025026 AGAAGGCATGAGGAAAAGGAAGG - Intronic
1131112733 15:89775880-89775902 ATAAGGCATCAAGACAAGCCCGG - Intronic
1131116330 15:89798329-89798351 GTCAGCCTTCAGGAAAAGCTTGG + Intronic
1133081987 16:3329140-3329162 AGAAGGCATCAGGAAGGGATGGG + Intergenic
1134924132 16:18143439-18143461 ATAAGGCAAGAGGTAAAGCAGGG + Intergenic
1138858456 16:60724539-60724561 AGAAGGCATCTGGAAGATCTAGG + Intergenic
1142978434 17:3658448-3658470 CAAAGGCATCAGGAAAGGCTGGG - Intronic
1144427925 17:15161866-15161888 ATAAGTCATCAGCAAGAACTTGG - Intergenic
1146698582 17:34932381-34932403 GTAAGGCATCAGCAAAAGCTTGG + Exonic
1149612382 17:57967103-57967125 ATTTGGCATAAGGAACAGCTGGG - Intergenic
1150166110 17:62945146-62945168 ATAAGGCACCTGGAAAAGGATGG - Intergenic
1151575696 17:74951680-74951702 ACAAGGCACCAGGAGGAGCTGGG + Intronic
1155373367 18:25129388-25129410 AGAAGACAACAGGAAAATCTAGG + Intronic
1155962926 18:32010052-32010074 ATTAGGCATAAGGAAAAGTGAGG - Intergenic
1156133295 18:34004916-34004938 CCAAGGCATCAAGAAAAGCAAGG - Intronic
1156655053 18:39275135-39275157 ATAAGACATCAGGGCAAGCAGGG + Intergenic
1157529092 18:48407350-48407372 ATGAGGGAGCAGGAAAAGTTGGG + Intronic
1158261441 18:55610303-55610325 GTAAGGCATAGGGAAAAGGTCGG - Intronic
1159945143 18:74439220-74439242 TTAAGGTACCAGAAAAAGCTGGG - Intronic
1159946626 18:74448655-74448677 ACCAGGCATCAGGAGAAGCCTGG + Intronic
1163328200 19:16618836-16618858 AGAAGGCATAAGGAAACGTTTGG + Intronic
1164499915 19:28810080-28810102 ATAAGGCATTATGACAAGTTAGG + Intergenic
1166421222 19:42638769-42638791 AAATGGCAACAGGAGAAGCTAGG - Intronic
1167220897 19:48197336-48197358 TGAAGACATGAGGAAAAGCTGGG + Exonic
1168647185 19:58067228-58067250 AAAAGGCTTCCGGAACAGCTCGG + Exonic
925601043 2:5609001-5609023 ATAAGCCATCAACAAAAACTAGG + Intergenic
926229407 2:10991223-10991245 ATGAGGCATCAAGAAAACCCAGG + Intergenic
926300754 2:11600354-11600376 AAAAGGCAGCAGGAAAGGATTGG - Intronic
926599339 2:14825075-14825097 ATTTGGCATCTGGAAAAGATGGG + Intergenic
927027849 2:19088612-19088634 AAAATGCATTAGAAAAAGCTAGG - Intergenic
927356140 2:22175617-22175639 ATGAAGCATCAGGCAAAGCCTGG + Intergenic
927576382 2:24205148-24205170 AAAAGTCATCAGCAAAAACTGGG + Intronic
927886629 2:26722867-26722889 AAAAGGCAGTGGGAAAAGCTGGG + Intronic
929614097 2:43294763-43294785 AGAAGGAATCAGGAGAAGGTGGG + Intronic
930822957 2:55666208-55666230 AAAAGGCATGAGGAAACTCTTGG + Intronic
931100236 2:58991313-58991335 ATTATGCCACAGGAAAAGCTGGG - Intergenic
931462082 2:62457899-62457921 ATAAGCCATGAGGAAAACGTTGG - Intergenic
933386166 2:81613314-81613336 ATAAGACATCAGGAAATGACTGG - Intergenic
940208264 2:151228712-151228734 ATATAGCATTAGGAAAAACTGGG + Intergenic
944209992 2:197197239-197197261 ATAAGGCAGCAGGAAGAGAGAGG + Intronic
945232751 2:207609665-207609687 TTAAGGAAGCAGGGAAAGCTTGG + Exonic
946166669 2:217868725-217868747 AAAAGGCAAGAGGCAAAGCTAGG + Intronic
947382486 2:229558794-229558816 ATGAGCCAGCAAGAAAAGCTGGG + Intronic
947743077 2:232493841-232493863 ACAAGGCAATAGGAAAATCTAGG - Intergenic
948519399 2:238526032-238526054 AAAAGGCAACAGGACATGCTGGG - Intergenic
948798365 2:240418635-240418657 GTGAGGCTTCAGAAAAAGCTTGG + Intergenic
1169946040 20:10990053-10990075 ATCAGCCATCAGAAAATGCTTGG + Intergenic
1171298122 20:24036523-24036545 AGAAGGCATCAGGGATAGCTGGG + Intergenic
1171314284 20:24174608-24174630 ATAAGGCAAAAGGAAAACCAAGG + Intergenic
1171992403 20:31706887-31706909 ATGAGGCAACAGGCAGAGCTTGG + Intronic
1174549577 20:51352271-51352293 AGATGGAATCAGGAAAAGCCTGG + Intergenic
1174749154 20:53094881-53094903 ATAATGCAACAGGTAAATCTGGG - Intronic
1178932722 21:36833703-36833725 ATAAGGCATCAGTCAAACCAGGG + Intronic
1179838269 21:44052159-44052181 TTAAAGCATCAGGACAGGCTCGG - Intronic
1181894680 22:26096606-26096628 ATGAGACATCAGGGAATGCTGGG - Intergenic
1181958332 22:26604637-26604659 AGAAGGCATAGGCAAAAGCTGGG + Intronic
1184400536 22:44271291-44271313 CTATGGCTTCAGGAATAGCTGGG - Intronic
949235997 3:1808683-1808705 ATAAAACATCAGCAAAAACTAGG + Intergenic
949392883 3:3582338-3582360 AGAAGGCATCAAGAAATGCAAGG - Intergenic
950893113 3:16422739-16422761 ATAAAGAATCAGGAATAGATTGG + Intronic
951659554 3:25047392-25047414 ACAATCCATAAGGAAAAGCTGGG + Intergenic
954298933 3:49689069-49689091 ATAAGGCAGCAGCAAAAGGGTGG - Intronic
956562789 3:70600235-70600257 ATAAGGCATCAAGAAAAGGAAGG + Intergenic
956970101 3:74513317-74513339 TTAAGGCATCAGGCAACTCTGGG - Intronic
958883788 3:99703093-99703115 ATAATGCATCAGCAAGACCTTGG + Intronic
958919892 3:100092742-100092764 ATAAGACATGAGGACAAGGTAGG - Intronic
961024734 3:123544499-123544521 AGAAGGAATAAGGAAATGCTAGG + Intronic
964801156 3:160559496-160559518 AAAAAGCATCAGTAAAAGATGGG + Intronic
965966565 3:174498158-174498180 AAGAGGCATCAGGAAACTCTTGG - Intronic
966095222 3:176192298-176192320 ATAAGGCAGGAGGAAAACATTGG - Intergenic
966646229 3:182248679-182248701 AGAAGGCCTCAGGAAACCCTGGG + Intergenic
971563139 4:28107122-28107144 ATAAACCATAAGGAAAAGCAAGG + Intergenic
972560010 4:40218567-40218589 GGAAGGCATGAGGAACAGCTTGG + Intronic
972956556 4:44399557-44399579 ATAAAGGATTAGAAAAAGCTAGG + Intronic
973785829 4:54331997-54332019 AAAAGGAAACAGGAAAAGCCTGG + Intergenic
974737318 4:65953475-65953497 ATAGGGCAACAGGTAAAGCAGGG - Intergenic
975179278 4:71325184-71325206 TTAAGGCATGAAGAAAATCTAGG + Intronic
975740030 4:77420752-77420774 AGAATGCATCAGTAAAAGATTGG - Intronic
977407420 4:96617642-96617664 ATTAGTCATCAGGAATATCTGGG - Intergenic
977434294 4:96973358-96973380 ATAAAGTATAAGGAAAAGCAAGG - Intergenic
977452273 4:97213816-97213838 ATATGGCAGCAGGTAGAGCTGGG - Intronic
979104883 4:116671885-116671907 ATAAATCATAAGGACAAGCTTGG - Intergenic
979862500 4:125711120-125711142 ATAAGGCATTAGAAAAAAATAGG - Intergenic
981420768 4:144547899-144547921 GTAAGGAATCAAGAAAAGTTTGG - Intergenic
981479112 4:145218476-145218498 ATAAGGCCTCAAGCCAAGCTGGG - Intergenic
982557921 4:156892198-156892220 ATAAAGCACCAGTAAATGCTGGG + Intronic
983915247 4:173284823-173284845 ATAAGGCTTCATTAAAAACTGGG - Intronic
985911130 5:2884159-2884181 ATAAGCCATCAGGGCCAGCTAGG + Intergenic
987038236 5:14038693-14038715 GTAAGTCAGCAGTAAAAGCTGGG - Intergenic
987475873 5:18392074-18392096 AGAAGGCATCAGGTACAGCAGGG + Intergenic
989999865 5:50880234-50880256 AAAAGAAAGCAGGAAAAGCTGGG + Intergenic
990231503 5:53717405-53717427 ATAAGGCATAAAGACAAGATTGG + Intergenic
990623650 5:57587735-57587757 AAAAGACATCAAGAAAACCTAGG + Intergenic
990718857 5:58670204-58670226 TGAAGGCATCAGGAAGTGCTGGG - Intronic
991652665 5:68872055-68872077 ATGAGGCATCAGGATGACCTTGG - Intergenic
994400279 5:99271295-99271317 ATAAAGAATCAGGCAAAGATGGG - Intergenic
996072496 5:119149463-119149485 ATAAAGAAACAGGAAAAGGTGGG - Exonic
996903221 5:128567723-128567745 ATAAGGAAACAGGAAAGGGTGGG - Intronic
998443504 5:142181078-142181100 ATGAGCAAACAGGAAAAGCTGGG + Intergenic
1001750689 5:174128826-174128848 ATAAAGAATCAGGGAAGGCTGGG + Intronic
1003181840 6:3798740-3798762 ATTGGGCAGCAGGAAATGCTGGG - Intergenic
1004428120 6:15519875-15519897 ATGTGGCATCAGGAGGAGCTGGG + Intronic
1004460843 6:15834416-15834438 ATAAGACCTCTGGAAAGGCTAGG - Intergenic
1004864663 6:19840220-19840242 ATATGGGATGAGGAAATGCTTGG + Exonic
1005401214 6:25436525-25436547 ACAAAGCAGCAGGAAAACCTAGG + Intronic
1006082387 6:31574997-31575019 TTGAGGCCTCAGGAAAGGCTGGG - Intergenic
1008711271 6:54230171-54230193 ATAAGGAATCAGGGAAGGGTGGG - Intronic
1010120372 6:72368941-72368963 AAATGGGATAAGGAAAAGCTTGG + Intronic
1010604528 6:77872068-77872090 ATAAGGAAACAGGAAAAACATGG + Intronic
1011220631 6:85051251-85051273 AAAGGACATCAGGAAAAGGTTGG + Intergenic
1012343992 6:98164801-98164823 ATAAGGAATGGGGAAAAGATGGG - Intergenic
1013638715 6:112053023-112053045 GTAAGGCAGCAGGAAAAGGAGGG + Intergenic
1014649950 6:124023909-124023931 ATATGGGATAAGGAAAAGATAGG + Intronic
1018569164 6:165188636-165188658 ATAAAGCAACAGGAAAAGGAGGG - Intergenic
1018875762 6:167821257-167821279 TTAAGGGATCAGGAAAATATGGG + Intergenic
1020412647 7:7910150-7910172 GCAAAGCATCAGAAAAAGCTCGG + Intronic
1021279114 7:18694978-18695000 ATAAAGCATGAGGAAAATTTAGG - Intronic
1022131794 7:27411451-27411473 ATAAGGAACCAGGAAGAGCAAGG - Intergenic
1026808558 7:73443433-73443455 ATAAGGCATTAGAAGATGCTCGG - Intronic
1027163210 7:75817159-75817181 ATAAGACATCATGATGAGCTGGG - Intronic
1027620923 7:80483883-80483905 ATGAGGTATTTGGAAAAGCTTGG + Intronic
1027706441 7:81539593-81539615 ATAAGGCAACAGGACAAGAAAGG - Intergenic
1030461350 7:109840045-109840067 ATGAGGCCTCAGGAACAGGTAGG - Intergenic
1031142515 7:117959888-117959910 ATAAGGCCACAGGAAAATATAGG + Intergenic
1031408162 7:121410277-121410299 ATGAGGTCTCAGGAAATGCTTGG - Intergenic
1032214917 7:129950526-129950548 AAAAGGCATCAGGTCAAGTTAGG + Intronic
1032492197 7:132331951-132331973 ATAAGGCATCTGGACAACCTTGG + Intronic
1032510842 7:132471142-132471164 ATAAGGCAGCAGCAAGAGATGGG - Intronic
1035115777 7:156522839-156522861 ACAAGGCGTCATTAAAAGCTCGG - Intergenic
1036046506 8:5147460-5147482 ATAAGGCAACAGGCAAAACAGGG + Intergenic
1038951919 8:32424445-32424467 ATCAGGAATCAGGAAAATCTGGG + Intronic
1039388168 8:37154767-37154789 ACCAGGCTTCAGGTAAAGCTGGG + Intergenic
1039811913 8:41056771-41056793 ATCAATCATCAGGAAAAGCCCGG - Intergenic
1041407203 8:57513070-57513092 AAAATGTATCAGGAAAATCTAGG - Intergenic
1042014073 8:64286989-64287011 GTATGGCATCAGGAATATCTTGG - Intergenic
1045458392 8:102405102-102405124 ATGAGACAACAGGAAAATCTGGG + Intronic
1045880325 8:107030561-107030583 ATAGGGCATCAGGTATGGCTTGG + Intergenic
1046339707 8:112837413-112837435 ATAAGTCCACAGGAAAAGCCTGG + Intronic
1048287146 8:133150768-133150790 AGAAGGCAGCAGGCAAACCTGGG + Intergenic
1049134379 8:140881710-140881732 AGAAGGCAACTGGAGAAGCTGGG - Intronic
1049930288 9:449599-449621 ATAAGGAATCAAGAAATGTTAGG + Intronic
1050046398 9:1550827-1550849 CTAAGGACTCAGGGAAAGCTGGG + Intergenic
1050281804 9:4058305-4058327 ATAAGGCATAAAAAAAAGCATGG + Intronic
1050555752 9:6788464-6788486 ATAATGCAACAGAAAAATCTGGG - Intronic
1051502506 9:17793278-17793300 ATAAAGATTCAGGAAATGCTTGG - Intronic
1052462125 9:28778285-28778307 ATAAGTCATAAGGAAAAGGATGG + Intergenic
1052524340 9:29594659-29594681 ATAAGACATGAAGAAAACCTTGG + Intergenic
1052841904 9:33298829-33298851 AGAAGGCAACAGGACAAGTTAGG + Intronic
1055181259 9:73389197-73389219 ATAGGGCAGCAGGCAGAGCTGGG - Intergenic
1055864193 9:80793204-80793226 TGAAGGCAGCAGGAAATGCTGGG - Intergenic
1055963899 9:81846432-81846454 GAAATGCATTAGGAAAAGCTGGG + Intergenic
1056280495 9:85037248-85037270 ACAAGGCTCCAGGAAAAGCAAGG + Intergenic
1059598679 9:115751832-115751854 ATAAAACATCAGGAAATGCTTGG + Intergenic
1185713882 X:2325905-2325927 ATTGGGCATCAGGAAAATTTAGG - Intronic
1186939973 X:14495832-14495854 ATTAGGCATCAAGAAGAACTGGG - Intergenic
1188122717 X:26329133-26329155 ATAACAGATTAGGAAAAGCTGGG - Intergenic
1188355808 X:29189446-29189468 ATAAGGGAACAAGAAAAACTAGG - Intronic
1188498659 X:30803361-30803383 GTAAGGCACAAGGCAAAGCTAGG - Intergenic
1188498913 X:30805159-30805181 ATAAGGCACAAGGAAAAGAAAGG - Intergenic
1189222744 X:39386241-39386263 GTAAATCATCAGGAATAGCTGGG - Intergenic
1190568504 X:51757055-51757077 ATAATGCATCAGGAACAAGTAGG + Intergenic
1193669136 X:84362344-84362366 ATAAGGCATCAGGAAAAGCTAGG + Intronic
1194472213 X:94310505-94310527 ATTAGGTATCAGGAAATGCTAGG + Intergenic
1195666823 X:107439291-107439313 ATAAGGCCTCTGGAAACCCTAGG + Intergenic
1196080747 X:111627979-111628001 AGAACGCATCAGGAAAGGCATGG - Intergenic
1197639074 X:128948115-128948137 ATAATCCATCAGTAAAAGATAGG + Intergenic
1197834909 X:130684127-130684149 AAAATGCATTAGGAAAAGCAAGG - Intronic
1198642973 X:138777074-138777096 GTCAGGGATCAGGAAATGCTGGG - Intronic
1198809922 X:140524765-140524787 AGAAGTCATCAGGAAACGCTTGG - Intergenic
1199043888 X:143146525-143146547 ATAAGAAAACAGGAAAAGGTGGG + Intergenic
1199806065 X:151301684-151301706 AGAAGGCACAAGGAAATGCTGGG - Intergenic