ID: 1193670521

View in Genome Browser
Species Human (GRCh38)
Location X:84379223-84379245
Sequence ATAATATTTCAGATCTATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 492
Summary {0: 1, 1: 0, 2: 4, 3: 32, 4: 455}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193670521_1193670523 -1 Left 1193670521 X:84379223-84379245 CCCATATAGATCTGAAATATTAT 0: 1
1: 0
2: 4
3: 32
4: 455
Right 1193670523 X:84379245-84379267 TTAGAGCTAAAGAGAGAGATAGG 0: 59
1: 176
2: 157
3: 160
4: 609

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193670521 Original CRISPR ATAATATTTCAGATCTATAT GGG (reversed) Intronic
900229477 1:1549071-1549093 ACAATATTCCAGATCTCTCTGGG - Intronic
900713878 1:4131818-4131840 ATAACATTTCACATCCATCTAGG - Intergenic
901613456 1:10518036-10518058 AGAAAATTTCAGACCTTTATGGG + Intronic
906000036 1:42416958-42416980 ATAATACTTCACCTTTATATAGG + Exonic
906762690 1:48390674-48390696 ATAATATTTTACATATTTATTGG - Intronic
907011088 1:50963975-50963997 ATAATATTTATTATTTATATTGG - Intronic
908094080 1:60718987-60719009 AAAATATGTCAGATCGTTATAGG + Intergenic
908230127 1:62096540-62096562 ATTATATTTCAGTTATATTTTGG + Intronic
908674616 1:66589792-66589814 AAAATATTTGAGATTTGTATAGG - Intronic
909074555 1:71037599-71037621 ATACTATTTCAGATATATGGGGG - Intronic
909463706 1:75948588-75948610 ATAATATTTTACATGTATATGGG - Intergenic
909476551 1:76087312-76087334 ACATTATTTCAGATTTATGTAGG + Intronic
909657557 1:78047500-78047522 ATAATACTTCACATTTATATAGG + Intronic
909705169 1:78572988-78573010 TTAATGGTTCAGTTCTATATTGG - Intergenic
909856798 1:80544678-80544700 ATAATATTTTAGCTACATATTGG - Intergenic
910329962 1:86060871-86060893 ATAATATTTAATATCAATAGGGG - Intronic
910970233 1:92848863-92848885 ATAATAATGCATATTTATATAGG + Intronic
911216073 1:95196502-95196524 ATAATAATTCATACCTTTATTGG + Exonic
912153782 1:106890477-106890499 ATCCTATTTCACATCTCTATTGG - Intergenic
912524112 1:110268107-110268129 AAAATATCTCAGATACATATGGG - Intronic
913181577 1:116327584-116327606 ATAAAATTTCAGGCCAATATGGG - Intergenic
915858284 1:159413971-159413993 ATAATATTTTACATATTTATGGG + Intergenic
916522421 1:165576158-165576180 ATAATATTATAGATCAATTTGGG - Intergenic
917204069 1:172550643-172550665 GTCTTATTTCAGATCTATATAGG + Intronic
917265609 1:173217671-173217693 ATAATATTTTGGATCTATTATGG + Intergenic
918117966 1:181512881-181512903 ATAGTATTACAGAACTATATTGG + Intronic
918735114 1:188051588-188051610 AGAAAATTTCAGAACCATATGGG - Intergenic
919872215 1:201830550-201830572 ATAAAATATCAGATCTATACAGG + Intronic
921399799 1:214708664-214708686 AAAAAATGTTAGATCTATATGGG + Intergenic
921421101 1:214949372-214949394 GTAAAATTTCAGAATTATATAGG + Intergenic
921593836 1:217033525-217033547 AGAATATTTCACATCTTTTTTGG - Intronic
922295337 1:224245102-224245124 ATAATATTTCAGATGTTAATAGG + Intronic
923987071 1:239393199-239393221 ACAATATTTAATATTTATATGGG - Intronic
924093817 1:240529967-240529989 TTAACATTTCAGCTCTATGTAGG + Intronic
924227007 1:241930158-241930180 ACAACTTTTCAGATCTTTATTGG - Intergenic
924841881 1:247720194-247720216 ATAATATTAATCATCTATATTGG - Intergenic
1063022064 10:2138905-2138927 ATAATATGTCTTATCTACATAGG + Intergenic
1063734776 10:8740422-8740444 ATAATCTTTCAGATGTAAACTGG + Intergenic
1063824233 10:9876385-9876407 TTCATATTTCAGAAATATATAGG + Intergenic
1063855375 10:10245629-10245651 ATATTTTTTCAGGTCTGTATTGG - Intergenic
1064685034 10:17852229-17852251 ATCATGTTTTAAATCTATATTGG + Intronic
1064686877 10:17871599-17871621 ATAATATTTCAGTGCGTTATTGG - Intronic
1064997814 10:21311971-21311993 ATAATATTTTACATGTTTATGGG + Intergenic
1065197989 10:23285521-23285543 ATAATATTTTGAATATATATTGG - Intronic
1065283509 10:24164840-24164862 ATAATATTTCTGAACTATTTGGG + Intronic
1065447937 10:25822302-25822324 ATCATACTTCAAATCTGTATTGG + Intergenic
1065577195 10:27133272-27133294 AAAATATTTGAGATCAATTTTGG + Intronic
1065695416 10:28375309-28375331 ATATTATTGCACATCTAGATGGG - Intergenic
1065731679 10:28715039-28715061 AAAATATATCAAATTTATATTGG - Intergenic
1067700161 10:48565764-48565786 ATGATAATTCATATTTATATAGG - Intronic
1068160793 10:53260956-53260978 ATAATATTTCAGATAAATATTGG - Intergenic
1068946647 10:62736216-62736238 ATACTATTTCATAGATATATTGG + Intergenic
1069128540 10:64669356-64669378 ATAATATTTTACATATATATGGG + Intergenic
1069227798 10:65965950-65965972 ATAATATTTGATATCTATATTGG - Intronic
1069262915 10:66421516-66421538 ATAATATTTTACATATTTATGGG - Intronic
1070488290 10:76951775-76951797 ATAACATTTCAGATATTTATAGG - Intronic
1071182245 10:83000481-83000503 AGAATATTTCAACTTTATATGGG - Intergenic
1071275494 10:84050498-84050520 ATAATATATCAGAACCAGATAGG - Intergenic
1072511663 10:96132174-96132196 TGAGTATTTCAGTTCTATATGGG + Intronic
1072554963 10:96507899-96507921 AAAATATTTCAGGGCAATATTGG - Intronic
1072806674 10:98427780-98427802 ATAATATTTCAGATATGTGGTGG - Intronic
1073505452 10:103984259-103984281 CTAATATTTCCAATTTATATAGG + Intronic
1074561248 10:114537269-114537291 ATAATATTTTACATATTTATGGG + Intronic
1075824315 10:125341624-125341646 ATATTATTTCAGCTCTATTTTGG + Intergenic
1077990486 11:7406046-7406068 AAAATATTATAGATATATATGGG + Intronic
1079854082 11:25578444-25578466 ATATTATTTCAGATCATTCTAGG - Intergenic
1080048353 11:27833402-27833424 ATAATATTTTACATATTTATGGG - Intergenic
1081047171 11:38290560-38290582 ATAATATTTTAGAGTTATGTTGG - Intergenic
1082168766 11:48976268-48976290 ATAATATTTCACTTTTACATTGG - Intergenic
1082192467 11:49263441-49263463 ATAATATTTCTTATCTTTCTGGG + Intergenic
1083648688 11:64187619-64187641 ATAATATTTCAGTTGTATCTAGG + Intronic
1085817358 11:79753841-79753863 ATAATATTTCACATATTTATGGG - Intergenic
1086185299 11:84006641-84006663 GTAATATTTTACATCTTTATGGG - Intronic
1086673654 11:89577526-89577548 ATAATATTTCTTATCTTTCTGGG - Intergenic
1086892958 11:92279569-92279591 ATAATATTTTACATATTTATGGG + Intergenic
1086998059 11:93381844-93381866 ATAATATTTTGGATATATAGTGG - Intronic
1087554691 11:99701629-99701651 ATAATATTTTAAAAATATATAGG - Intronic
1090583959 11:128190099-128190121 ACAATGTTTCAGCTCTACATGGG + Intergenic
1091479329 12:810324-810346 AAAATATTTTAGGTCAATATTGG - Intronic
1091523371 12:1270656-1270678 ATAATATTTAATATATCTATTGG + Intronic
1091570914 12:1685034-1685056 ATAATATTTCAAAGTTATAAAGG - Intergenic
1092252672 12:6909021-6909043 ATAATATATAATATATATATCGG - Intronic
1093304950 12:17504665-17504687 ATAATTATTCAGATCAAAATAGG - Intergenic
1093709740 12:22316858-22316880 ATAATTTTTCACCTATATATTGG + Intronic
1094431190 12:30371515-30371537 ATAAAATTTTATATCTCTATCGG + Intergenic
1095656541 12:44676142-44676164 AAAATAATACAGATCAATATGGG + Intronic
1095785466 12:46104353-46104375 TTACTCTTTCAGATGTATATAGG + Intergenic
1096902556 12:54900299-54900321 ATAATATTTCACATATTTGTAGG - Intergenic
1097293468 12:57940072-57940094 ATAGTATTTCAAATGTATATAGG + Intergenic
1098776302 12:74623247-74623269 AAAATGTGTAAGATCTATATGGG + Intergenic
1099338404 12:81395255-81395277 ATCATATATAAGATCTCTATGGG + Intronic
1099619980 12:84990840-84990862 AGAATATTTAAGATGCATATTGG + Intergenic
1099711573 12:86232539-86232561 GTAATTTTTCAGATAAATATGGG + Intronic
1100017632 12:90030720-90030742 ATAATATTCAAGCTCTATATGGG - Intergenic
1100487684 12:95046138-95046160 GTAATATTTAAGATTTTTATTGG - Intronic
1100783793 12:98057673-98057695 ATCACATTTTAGATCTAAATTGG - Intergenic
1100801659 12:98238035-98238057 ATAAATTTTCAGATTTAGATTGG - Intergenic
1104138290 12:125961238-125961260 CTAAAATTTAAGATCTATGTGGG + Intergenic
1105967809 13:25400391-25400413 ATAATATTTTATATATTTATGGG + Intronic
1106261915 13:28075392-28075414 ATAATATTTTACATATTTATGGG - Intronic
1107000011 13:35532598-35532620 TTGACATTTCTGATCTATATTGG + Intronic
1107365812 13:39674010-39674032 ATAATATTTTTCATCTACATTGG - Intronic
1107388280 13:39936833-39936855 AGAATATTTCACATCTTGATTGG + Intergenic
1108109510 13:47053546-47053568 ATAATATTTTACATGTTTATTGG - Intergenic
1108459252 13:50648736-50648758 ATAATATTTTACATATTTATGGG + Intronic
1109006008 13:56877593-56877615 ATAATAGTTCATTTCTATTTTGG + Intergenic
1109100456 13:58178124-58178146 ATAATATTTGATATATATCTGGG + Intergenic
1109668414 13:65569542-65569564 ATAATAATTGAGATATATTTGGG - Intergenic
1109688498 13:65852798-65852820 ATACTATTTATGATCTATACTGG + Intergenic
1109818250 13:67616878-67616900 AAAATATTTTGGATCTACATGGG - Intergenic
1109882385 13:68496478-68496500 AAAATATTTCTTAACTATATTGG + Intergenic
1110151019 13:72253315-72253337 ATAATATTTCAGTTCCATTCTGG - Intergenic
1110938182 13:81318559-81318581 ATAATATTTCCTATCTTTATGGG + Intergenic
1111058910 13:82986334-82986356 ATAAAATTTCAGATTGCTATAGG - Intergenic
1111137903 13:84074010-84074032 ATAAAATATCAGATATAAATGGG - Intergenic
1111303830 13:86381081-86381103 ATAATGTTTTACATCTATCTTGG - Intergenic
1111359311 13:87153979-87154001 ATTATTTTTCACATCTTTATAGG - Intergenic
1112038081 13:95516212-95516234 AGAATATTTCTCATCTGTATCGG + Intronic
1112493955 13:99890984-99891006 ATAATATTTCAAAAATATATAGG + Intronic
1112694515 13:101932583-101932605 ATAAAATTACAGATTTACATAGG + Intronic
1113195448 13:107798920-107798942 ATAATATTCCTGACATATATAGG - Intronic
1113259084 13:108541176-108541198 ATATTTTTTCAAATCAATATGGG + Intergenic
1113516687 13:110908229-110908251 TTAATTTTTCATATCTAGATTGG - Intronic
1113959474 13:114118593-114118615 AAAATATTTCAGAAATATTTGGG - Intronic
1114029483 14:18564663-18564685 AAAATATTTGAGATCAATTTTGG - Intergenic
1114736135 14:25045919-25045941 ATAATTTTTAAGATCCATCTGGG + Intronic
1114809850 14:25885434-25885456 ATAATATTTAATATCTATATAGG + Intergenic
1115695209 14:35890379-35890401 ATAATATTTTATATATTTATGGG + Intronic
1117935267 14:60897621-60897643 ATAATATTTTACATATTTATGGG + Intronic
1118407045 14:65435281-65435303 ATAATATTTTCTATCCATATTGG + Intronic
1118641527 14:67797170-67797192 TTACTAGGTCAGATCTATATGGG - Intronic
1119020729 14:71110123-71110145 AAAATATTTCAGCTTTATTTGGG - Exonic
1119112124 14:71984650-71984672 AGAATATATCAGATGTATTTAGG + Intronic
1120361976 14:83515627-83515649 ATATTATTTCAGATCTTATTGGG - Intergenic
1120423870 14:84322655-84322677 ATAATATTTTACATATTTATGGG - Intergenic
1120536910 14:85707702-85707724 ATAATACCTCAGATTTATAATGG + Intergenic
1125150390 15:36524119-36524141 ATAATCTTTCAGCTTTATTTGGG + Intergenic
1125173197 15:36790635-36790657 ATAATATTTTAGACATTTATGGG - Intronic
1125864375 15:43031152-43031174 ATTATATTTCTGATCTATAGTGG - Intronic
1126943842 15:53795135-53795157 ATAATATTTTAGATTTCTAGTGG - Intergenic
1127912115 15:63425475-63425497 ATACTTTTTCAGATCTACAAAGG - Intergenic
1129553442 15:76478798-76478820 ATAAAATTGCAGATCTCTAAAGG + Intronic
1130727145 15:86450919-86450941 ATAATATTCCAGCTATTTATAGG + Intronic
1131603502 15:93875646-93875668 ATAATATTTTACATGTTTATGGG + Intergenic
1131630831 15:94175214-94175236 AAAATATTTCAGTTATATATTGG + Intergenic
1131952814 15:97699809-97699831 AATATATTTCAGATGTATAAGGG - Intergenic
1132133808 15:99311966-99311988 AATATATTTCAGGTCAATATTGG - Intronic
1134898646 16:17914093-17914115 ATAATATTTTACATATTTATTGG - Intergenic
1136704629 16:32176659-32176681 AAAATATTGCAGATCAAAATTGG + Intergenic
1136763284 16:32752747-32752769 AAAATATTGCAGATCAAAATTGG - Intergenic
1136804816 16:33117639-33117661 AAAATATTGCAGATCAAAATTGG + Intergenic
1138054514 16:53818525-53818547 AAAATATTTTACATTTATATTGG + Intronic
1138921981 16:61542036-61542058 ATAATATTTTACATATTTATGGG - Intergenic
1140183877 16:72748942-72748964 AAAATAATTCTGATGTATATTGG + Intergenic
1140610201 16:76589490-76589512 ATACTATTTTAGATTAATATTGG - Intronic
1203065435 16_KI270728v1_random:1013069-1013091 AAAATATTGCAGATCAAAATTGG - Intergenic
1143834650 17:9680983-9681005 ATAATATATAATATATATATGGG - Intronic
1144447726 17:15346293-15346315 ATAATCTTGCAGATCTTTAAAGG - Intergenic
1146324475 17:31873814-31873836 ATAATATTTTACATATTTATAGG - Intronic
1147233249 17:39035273-39035295 TTAAAATTTCATATCTACATAGG - Intergenic
1147349807 17:39832984-39833006 ATAATATTTTACATATTTATGGG - Intronic
1149151250 17:53566605-53566627 ATAATATTTTACATATGTATTGG - Intergenic
1149530682 17:57392487-57392509 ATTATATTCCAGCTCCATATAGG + Intronic
1149953122 17:61013426-61013448 ATAATTATTTACATCTATATTGG + Intronic
1150669038 17:67173550-67173572 AAAAAATTTCAAACCTATATAGG + Intronic
1152826210 17:82466808-82466830 ATAATATTTCAGGTCAACAGGGG - Intronic
1153286609 18:3461817-3461839 ATTATATTTCACTTCTGTATGGG + Intergenic
1153519226 18:5936450-5936472 GTAATATTTTACATCTGTATAGG - Intergenic
1153600065 18:6771996-6772018 ATAATATTTTACATATTTATGGG - Intronic
1153736175 18:8070415-8070437 ATAAAATTTCAGCACTAAATAGG + Intronic
1154098157 18:11440298-11440320 ATAATATTTCATTTATTTATGGG - Intergenic
1154136166 18:11780505-11780527 AAAATATTTCAGCTGTAAATTGG + Intronic
1155060141 18:22221165-22221187 ATAATATTTTGTATGTATATAGG + Intergenic
1156990038 18:43398578-43398600 ATAATATTTCAGTTCAGTATTGG - Intergenic
1157001678 18:43534366-43534388 ATATTTTTTCACATCTAAATAGG - Intergenic
1159149838 18:64506342-64506364 AGAATTTTTCATATGTATATTGG + Intergenic
1159270093 18:66137957-66137979 TTAACATTTCAGAGCTACATTGG - Intergenic
1159415454 18:68141797-68141819 ATGATATTTCAAATATGTATTGG - Intergenic
1159747211 18:72252615-72252637 ATAATATTTTACATATTTATAGG - Intergenic
1159793873 18:72817893-72817915 ACAATATTTCCATTCTATATGGG - Intronic
1163904676 19:20141957-20141979 ATAATATTTCATATTTCTTTGGG - Intergenic
1164798949 19:31060004-31060026 ATAATATTTTACATGTTTATGGG - Intergenic
1164894405 19:31859375-31859397 ATAATATTTTACATATTTATGGG + Intergenic
1165407663 19:35640734-35640756 AAAATATTTTATATATATATAGG + Intergenic
1165602627 19:37069311-37069333 ATTATATTTCTTAACTATATAGG - Intronic
1165696522 19:37905297-37905319 ATAATATTTTGGATATATTTGGG + Intronic
926556921 2:14368782-14368804 ATCATATTTTACATCTTTATTGG - Intergenic
926903839 2:17787491-17787513 ATAATATTTTAGAAGTCTATGGG - Exonic
927126315 2:20014712-20014734 ATAATATTTAATAGCTATCTGGG + Intergenic
928208057 2:29301462-29301484 ATAAAATTGCATATCTATATAGG + Intronic
928263094 2:29785495-29785517 ATCATCTTTCAGATGTATTTGGG - Intronic
928614408 2:33022320-33022342 ATAATACTTCAGTTCTATTGTGG + Intronic
928657177 2:33464430-33464452 ATTATATTTTATATCTATTTTGG + Intronic
928829813 2:35466755-35466777 ATCATATTTCAGATTTAATTTGG - Intergenic
929230954 2:39559589-39559611 ATAATATTTTACATATTTATGGG + Intergenic
929309653 2:40407597-40407619 AGAATATCACAGCTCTATATTGG + Intronic
931054535 2:58454139-58454161 ATAACATTTCTGATGGATATAGG + Intergenic
931093318 2:58911004-58911026 ATATGATTTCATCTCTATATTGG + Intergenic
931373945 2:61690941-61690963 TTAACATTTTAGATCTATGTAGG + Intergenic
931833446 2:66075407-66075429 ATAGAATTTCAGACCTAGATTGG + Intergenic
931855736 2:66300083-66300105 ATAATATTTTACATATTTATGGG - Intergenic
932995554 2:76846998-76847020 ATAATATTTGAGATAGATTTTGG + Intronic
933096722 2:78192516-78192538 ATAATAATTCATATATATCTAGG + Intergenic
934784568 2:96995693-96995715 AAAATGTTTTAAATCTATATAGG + Intronic
935508259 2:103934805-103934827 GTAATTTTACAGATCTATCTGGG - Intergenic
935653480 2:105401347-105401369 ATAGTATTTCGTATATATATAGG - Intronic
935657499 2:105437405-105437427 ATAATATTTTACATATTTATGGG - Intronic
936892641 2:117390455-117390477 ATAAAATTTCAGCTATATGTGGG - Intergenic
938196118 2:129330213-129330235 AAAATATATCATATCTATATTGG + Intergenic
939032478 2:137093117-137093139 ATAATATTTCAAATATTAATTGG - Intronic
939169088 2:138673390-138673412 ATAATATTTTACATATTTATGGG + Intronic
939772909 2:146345544-146345566 ATAATATTTCATATGAACATTGG + Intergenic
940204473 2:151187805-151187827 ATAATATTTCACATGTATTGAGG + Intergenic
940505410 2:154547099-154547121 ATTAGATTTCAGATTTACATGGG + Intergenic
940603412 2:155889236-155889258 ATAATATTTCACATACTTATAGG - Intergenic
940743855 2:157544999-157545021 GTTATATTTCTGATCTTTATTGG - Intronic
941253795 2:163201537-163201559 ATAATATTTCACAGCTAGAATGG + Intergenic
941720247 2:168804883-168804905 ATAAAATTTCTGATTTTTATTGG - Intronic
942375734 2:175334955-175334977 ATAATATTTTATATATTTATAGG + Intergenic
943152128 2:184127015-184127037 ATAATATTTAAGATATATCAAGG - Intergenic
943227581 2:185198928-185198950 ATAATATTTTAAATTTGTATTGG - Intergenic
943322550 2:186463450-186463472 ATAATAACTCAGATAAATATAGG - Intergenic
943839340 2:192558939-192558961 ACAATATTTCATATGTTTATAGG + Intergenic
943972678 2:194431173-194431195 ATTATATTCCACATTTATATAGG - Intergenic
944282889 2:197918477-197918499 ATAATATGTAAGATATAAATAGG + Intronic
944383858 2:199142271-199142293 AACATATTTCATATCTGTATGGG + Intergenic
944761472 2:202819609-202819631 ATAAAATTTCAGATGTTTTTTGG - Intronic
945585339 2:211654350-211654372 ATTATATTTAAGTTCTAAATAGG + Intronic
946884255 2:224207199-224207221 ATAATATTTAAGCCCTATAAAGG - Intergenic
947307438 2:228762904-228762926 ATAATATTTTACATATTTATGGG - Intergenic
1169630874 20:7629856-7629878 CTAATATTTCACAATTATATAGG + Intergenic
1169694163 20:8368624-8368646 ATGATGTTTTACATCTATATAGG - Intronic
1170003406 20:11639995-11640017 GTAATATTTTAAATATATATGGG - Intergenic
1170170780 20:13409706-13409728 ATAATATTTTACATATGTATGGG + Intronic
1170753991 20:19181303-19181325 ATAACATTTTAGATTTATTTTGG + Intergenic
1171254450 20:23678690-23678712 ATAGTATTTCTGATTTATTTTGG + Intergenic
1171933196 20:31247146-31247168 ATAAATTTTCAGATCTAAATTGG + Intergenic
1172336139 20:34117459-34117481 ATTGTATTTGAGATCTATTTTGG - Intergenic
1173449213 20:43147616-43147638 CTAACATTTCAAGTCTATATTGG + Intronic
1174694066 20:52539756-52539778 AGTATATTTGGGATCTATATTGG - Intergenic
1176358921 21:5976227-5976249 ATAATATTTTATATATTTATGGG + Intergenic
1176727521 21:10452463-10452485 ATAACATTTCAGTGCTATTTTGG - Intergenic
1177529100 21:22337346-22337368 ATTGTATTTCAGACCTCTATGGG + Intergenic
1178352514 21:31882550-31882572 ATAATATTTTACATATTTATGGG + Intronic
1179253016 21:39689311-39689333 ATAATATTTTACATGTTTATGGG + Intergenic
1179764597 21:43562323-43562345 ATAATATTTTATATATTTATGGG - Intronic
1180259554 21:46659541-46659563 ATAATTTTTCATATATTTATTGG - Intronic
1180286877 22:10754568-10754590 ATAACATTTCAGTGCTATTTTGG + Intergenic
1180453598 22:15491713-15491735 AAAATATTTGAGATCAATTTTGG - Intergenic
1182232481 22:28849273-28849295 ATAATATTTCACATATTGATGGG + Intergenic
1182686664 22:32125971-32125993 ATAAAATTTGAGATATATAGGGG + Intergenic
1183114129 22:35676518-35676540 AATATATTTAAGATATATATTGG - Intergenic
1184303248 22:43576327-43576349 AAAATATTTCCAATTTATATAGG + Exonic
951444248 3:22759014-22759036 ATTTTATTTCAGATGAATATGGG + Intergenic
951510311 3:23493322-23493344 GTAATATTTCAGCTGTACATAGG + Intronic
951869183 3:27341456-27341478 ATAATATTTTACATATTTATGGG - Intronic
952346745 3:32495069-32495091 ATAGTAATTCAAATCTATACTGG + Intronic
953140902 3:40228304-40228326 ATAATATTTTACAACTGTATTGG + Intronic
953466942 3:43130246-43130268 ATAATCCTTAAGATTTATATTGG + Intergenic
953592722 3:44274931-44274953 ATAATATTTTACATATTTATGGG + Intronic
953832857 3:46316769-46316791 ATAATATTTCAAATCCATATGGG - Intergenic
954054508 3:48010572-48010594 ATACGATCTCAGATGTATATGGG + Intronic
955694523 3:61622497-61622519 ATAATCTTTCAAATCAAAATGGG - Intronic
955731182 3:61988822-61988844 ATAATATTTCATTTCCAAATAGG + Intronic
955733608 3:62013712-62013734 ATAGTAGTTCAGTTTTATATTGG + Intronic
956538077 3:70301991-70302013 ATTTCATTTCAGATCCATATTGG + Intergenic
956888450 3:73585041-73585063 ATAACATTTCAGCTTTAAATTGG + Intronic
957010602 3:75001377-75001399 ATAGTATTTCAGATTCATAGTGG + Intergenic
957567641 3:81905396-81905418 TTAATATTTGATCTCTATATAGG + Intergenic
957829175 3:85493145-85493167 ATAATAATTTTAATCTATATTGG + Intronic
957855507 3:85871445-85871467 ATAATATTTAAGAGATCTATAGG + Intronic
958639590 3:96788282-96788304 ATAATATTTTACATATTTATGGG + Intergenic
959166790 3:102790069-102790091 TTGGTATTTCAGATCGATATTGG - Intergenic
959267038 3:104155861-104155883 ATAAAATTTCAAATGTAAATTGG + Intergenic
959311710 3:104746248-104746270 ACAATTTTTCAGATCTAGATAGG + Intergenic
960280978 3:115781222-115781244 AAAATATTCAAGATCTATTTTGG + Intergenic
961161211 3:124727957-124727979 CTAATATTCCATAACTATATTGG - Intergenic
961630194 3:128292169-128292191 ATAATATTTCATAACAAAATAGG - Intronic
961689839 3:128661235-128661257 ATAATGTTTCAGGTTTATTTTGG + Intronic
961959554 3:130840362-130840384 ATAACATGTCAGATCTAGACAGG + Intergenic
962198088 3:133380354-133380376 AAAATCTTTCAGATCTACAAGGG + Exonic
962585334 3:136837209-136837231 ATAATATTTCACCTCTGTTTTGG + Intronic
963189986 3:142459157-142459179 TTAATATTTTAGATTTATATTGG - Intronic
963215153 3:142738114-142738136 ATAAAATGTAACATCTATATAGG - Intronic
964210701 3:154224035-154224057 ATAGTATTTCAGTACTATTTAGG + Intronic
964242305 3:154610403-154610425 ATTATATTTCACTTATATATTGG + Intergenic
965076346 3:163982189-163982211 ATAATTTTTCATGTCAATATAGG + Intergenic
965132632 3:164721499-164721521 ATAATAAATCAAATCCATATGGG - Intergenic
965306018 3:167064467-167064489 TAAATATTGAAGATCTATATAGG - Intergenic
965860878 3:173148135-173148157 ATAATATTTCCTTTATATATAGG - Intergenic
965898798 3:173613603-173613625 ATAATATTACAGTTTTAAATTGG - Intronic
966105481 3:176327772-176327794 ATAATATTTTACATATTTATGGG - Intergenic
966694052 3:182771239-182771261 ATAATATTTTATATATTTATGGG + Intergenic
966740861 3:183232058-183232080 ATATGAACTCAGATCTATATGGG + Intronic
966745591 3:183273364-183273386 ATAATTTTTCAGTTGTTTATTGG - Exonic
966774842 3:183534766-183534788 ATGATATTTCAGGTATATTTTGG - Intronic
967571298 3:191031706-191031728 ATAACATTTCAGTTTTATGTTGG - Intergenic
970530588 4:16978240-16978262 ATAATATATTATATATATATGGG - Intergenic
971125812 4:23752721-23752743 ATAGTGTTTCAGATATATTTTGG - Intergenic
971366339 4:25980292-25980314 ATAATATTTGAGATATTGATAGG - Intergenic
971650179 4:29261661-29261683 ATACTATTTCATGTCTTTATGGG + Intergenic
971839460 4:31815787-31815809 ATTATATATAAAATCTATATAGG + Intergenic
972103915 4:35458896-35458918 ATAATATTTCCTTTATATATCGG + Intergenic
972432188 4:38993678-38993700 TTAATTTTACATATCTATATCGG + Intronic
973091164 4:46138106-46138128 ATAATATTTCAGAGATTAATTGG - Intergenic
973605543 4:52583667-52583689 ATAAAAGTTCAGATGTAAATTGG + Intergenic
973703586 4:53560159-53560181 TTAAGAGTTCTGATCTATATAGG - Intronic
973801000 4:54478278-54478300 ACAATATTGCAGATGTATTTTGG + Intergenic
974072213 4:57134602-57134624 ATAATATTTTACATATTTATGGG + Intergenic
974617011 4:64301973-64301995 ATAATGTTTCACATTTAGATAGG + Intronic
974789375 4:66667361-66667383 AAAATATTTTAGATATAAATGGG - Intergenic
974912354 4:68137966-68137988 ATAATATTTTACATATTTATAGG - Intergenic
976555896 4:86451435-86451457 ATAATATGTCATATAAATATTGG - Intronic
976906816 4:90247374-90247396 ATAATAATTCACAACAATATCGG + Intronic
976959737 4:90955526-90955548 ATAATATTTAAGTAGTATATTGG + Intronic
977077192 4:92469993-92470015 AAAATATTTCATGTCTGTATAGG - Intronic
977417819 4:96757443-96757465 AGAATATTTTACATATATATGGG + Intergenic
978308570 4:107360285-107360307 AGATTATTTTAGATTTATATGGG - Intergenic
978720839 4:111907149-111907171 GTAATGTTGCATATCTATATCGG + Intergenic
978956287 4:114616834-114616856 AAAATATTTCAGTAGTATATTGG + Intronic
979077172 4:116286910-116286932 ATAATATTTTAAATCTTCATTGG - Intergenic
979096296 4:116554979-116555001 ATTTTAATTCAGATCCATATAGG - Intergenic
979193126 4:117887587-117887609 ATAGTATTTCAGATACATATGGG + Intergenic
979841602 4:125449032-125449054 CCAATATTTCAGATATAAATGGG - Exonic
980898249 4:138880028-138880050 ATAATATTTCAGAATGATAATGG - Intergenic
981549686 4:145931400-145931422 ATCAGATTTCATAACTATATTGG - Intronic
981895107 4:149789262-149789284 ATAATATTTTAAATATTTATGGG - Intergenic
982514780 4:156331494-156331516 ATAATATTTCACATATGTGTGGG - Intergenic
982818212 4:159913345-159913367 ATAATATTTTATGTATATATGGG + Intergenic
983210655 4:164954509-164954531 ATATAATTTTAGATGTATATTGG - Exonic
983425141 4:167574447-167574469 TTATTATTTACGATCTATATTGG - Intergenic
983474195 4:168194720-168194742 ATAATATTTTACATATTTATGGG - Intergenic
983551383 4:169020907-169020929 ATTATATTTCACAACTGTATTGG - Intergenic
983614858 4:169691745-169691767 ATAATATTTTAAATATATTTTGG - Intronic
983733280 4:171024636-171024658 ATAATAAAACAGATTTATATTGG + Intergenic
983801246 4:171932134-171932156 ATAATATTTTAGAAAAATATAGG + Intronic
983951790 4:173650724-173650746 AAACTCTTCCAGATCTATATGGG + Intergenic
985208900 4:187571076-187571098 ATAATATTTAAAATATAGATTGG + Intergenic
985325584 4:188765382-188765404 ATAATATTTTAGTTGTATAAGGG - Intergenic
987163789 5:15172960-15172982 CTAATATGTTAGATCTATTTGGG - Intergenic
987313587 5:16703454-16703476 AGAATATATCAGATCTCTTTGGG - Intronic
987560786 5:19516967-19516989 ATAAAATTTCATATCTCTGTGGG + Intronic
987734813 5:21826887-21826909 TAAATATTTTAGAACTATATTGG + Intronic
988393818 5:30670961-30670983 ATAATATATTATATATATATAGG + Intergenic
989271327 5:39536863-39536885 ACAATATTTAAAATCAATATTGG + Intergenic
989304304 5:39934531-39934553 ATAATATTTTAAATGTCTATTGG + Intergenic
989508267 5:42253730-42253752 ATAAAATTTCAGAGACATATAGG + Intergenic
990174982 5:53097778-53097800 AAAAAATTTAAGAACTATATGGG + Intronic
990525462 5:56622109-56622131 ATAGTATTTCAGATTTAAACTGG + Intergenic
991123261 5:63041119-63041141 TTAATATTTCAGAAATATTTAGG + Intergenic
993211481 5:84957984-84958006 ATAATATTTAATAACTATTTAGG + Intergenic
993802004 5:92353443-92353465 ATTATATTGCAGACCTGTATGGG + Intergenic
994076376 5:95654721-95654743 TTAATAAGGCAGATCTATATGGG + Intronic
994310236 5:98260596-98260618 ATAATATTACAAATATACATTGG - Intergenic
995653073 5:114393349-114393371 AGAATATTTTAGATGTAAATTGG + Intronic
995967180 5:117921858-117921880 ATAATATTTTACATATTTATGGG - Intergenic
996789207 5:127274152-127274174 ATAAGATCTCAGATCTGTTTGGG - Intergenic
997123888 5:131205973-131205995 ATAATATTTACCAGCTATATGGG - Intergenic
999220283 5:149970555-149970577 ATAATCTCCCAGATCTATACAGG - Intronic
999945821 5:156594197-156594219 ATAAAATTTTAAATGTATATTGG + Intronic
1000359824 5:160436457-160436479 ATCATATTTCACATCTAGAGTGG - Intergenic
1000650272 5:163809299-163809321 AAAATAATTCAAATTTATATGGG - Intergenic
1001643082 5:173259090-173259112 ACAATATTTCCAATCTATACTGG - Intergenic
1003823469 6:9926353-9926375 AAAATATTTCAGTTTTACATTGG + Intronic
1004372421 6:15064006-15064028 ATAATATCTCTTCTCTATATGGG - Intergenic
1007834160 6:44661976-44661998 CTAATATTTTAGATATATAGTGG - Intergenic
1008170968 6:48204851-48204873 AAAATATTTAGGCTCTATATAGG - Intergenic
1008428360 6:51385482-51385504 ATAATATTTCATATTAATAGGGG + Intergenic
1008908697 6:56709307-56709329 ACAATATTTCAAATTTATTTTGG + Intronic
1009339668 6:62538593-62538615 TTAATTTTTCTGATCTATACTGG + Intergenic
1009823876 6:68841090-68841112 ATAATATTTGTTTTCTATATTGG - Intronic
1010107661 6:72188282-72188304 ATATGATTTCAGATGTGTATGGG - Intronic
1010403861 6:75480230-75480252 AAAAGATTTCAAATCTATACTGG - Intronic
1010814151 6:80336350-80336372 ATGTTATTTCTGATCTAAATGGG - Intronic
1010881139 6:81173792-81173814 ATAATAAATTAGATCTATACAGG - Intergenic
1011438916 6:87367535-87367557 ATAGTATCTAAGATCTATAAAGG - Intronic
1012002894 6:93676341-93676363 ACAATCATTCAGATCTCTATTGG + Intergenic
1012077406 6:94708035-94708057 ATAGTTTCTCAGATATATATTGG - Intergenic
1012319022 6:97819502-97819524 ATAATCTTTCATAGATATATTGG + Intergenic
1012337451 6:98078644-98078666 ATAATTTCTCAGATCAAGATTGG - Intergenic
1012355857 6:98313482-98313504 ATAATATTTCAGCTTTCTGTAGG - Intergenic
1012768806 6:103402845-103402867 ATAATATTTCAAATTTAAAATGG + Intergenic
1013608185 6:111770248-111770270 ATAATATTTTGGACATATATTGG + Intronic
1013658617 6:112271614-112271636 ATAATATATAATATATATATTGG - Intergenic
1013667653 6:112365264-112365286 ATAATATTTCACAGATTTATGGG - Intergenic
1014091161 6:117404817-117404839 ATAAAATTTCAGAAATATATTGG - Intronic
1014181922 6:118394130-118394152 ATATTATTTCAAATCTTTTTTGG - Intergenic
1014426913 6:121318282-121318304 ATAATATTTAAAATCTCTTTCGG + Intronic
1016897610 6:149068619-149068641 ATAATATTTTACATATTTATGGG + Intronic
1017572980 6:155767218-155767240 ATAATATTTTACATATTTATGGG - Intergenic
1017636734 6:156451459-156451481 AAAATATTTGAGATAGATATTGG - Intergenic
1017651310 6:156585497-156585519 AAAATATTTCAAATCTAGAAAGG - Intergenic
1020146462 7:5647815-5647837 ATAATACTACAAACCTATATTGG + Intronic
1020833290 7:13117561-13117583 ATAATATTTTTTCTCTATATTGG - Intergenic
1021627259 7:22605834-22605856 ATAATATTTTACATATTTATGGG + Intronic
1022793173 7:33709217-33709239 ATAATATATCATATCTAAGTAGG + Intergenic
1022886971 7:34656656-34656678 ATAATTTTTCATCTCTATCTGGG - Intergenic
1023070207 7:36422959-36422981 AGAAAACTTCAGATATATATAGG + Intronic
1024923220 7:54583162-54583184 ATAATATTTTCCATATATATGGG - Intergenic
1025156309 7:56609446-56609468 ATAATATTGTAGATCTAGAAAGG + Intergenic
1026009596 7:66626597-66626619 ATAATATTTTACATATGTATGGG + Intergenic
1027420084 7:78010156-78010178 TGAACATTTCAGCTCTATATAGG - Intergenic
1027663303 7:81013613-81013635 ATAATATTTCAGGTCTCCAATGG - Intergenic
1027816973 7:82987382-82987404 ATAGTATGTCAGATATAAATGGG + Intronic
1030054339 7:105569539-105569561 AGAATATTTAATATCTCTATTGG - Exonic
1030273481 7:107694732-107694754 ATCTTATTTCAGATAAATATAGG - Intronic
1030319787 7:108153239-108153261 ATAATATTTCATATCCAGGTTGG + Intronic
1031210169 7:118814662-118814684 ATAATATATCAGATAGATGTTGG - Intergenic
1031262657 7:119541620-119541642 AAAATATTGCAGATATGTATTGG - Intergenic
1031289126 7:119909764-119909786 ATATTTTTTCAGATATATTTTGG + Intergenic
1031302761 7:120083943-120083965 ATTATATTTCAGAAGTATTTAGG + Intergenic
1031476895 7:122234226-122234248 AAAATATTTCAGTACTATATAGG + Intergenic
1031569197 7:123337167-123337189 ATAATATTTTACATATTTATGGG - Intergenic
1031956806 7:127950758-127950780 ATTAAATCTCAGATGTATATAGG + Intronic
1033019928 7:137714238-137714260 TTAAAATTTTAGATCTATAAAGG - Intronic
1033204630 7:139407710-139407732 AAAATATTTCAAATTAATATTGG - Intronic
1033805343 7:144947679-144947701 ATAATTTTTAAAATATATATGGG - Intergenic
1033853347 7:145525410-145525432 ATAATATCACAGTTCTATAGAGG - Intergenic
1034602581 7:152275530-152275552 ATAACATTTCAGTGCTATTTTGG + Intronic
1035195400 7:157215444-157215466 ATAATATATCTAATCTATACTGG - Intronic
1035415072 7:158676573-158676595 ATATCATTTCAGCTCTAAATGGG - Intronic
1035815221 8:2531775-2531797 ATAATTTTTAAGATCTTTAGTGG - Intergenic
1035936866 8:3851063-3851085 GGAATATTTCAAATCTATTTAGG + Intronic
1037114577 8:15208272-15208294 ATAATATGCCATACCTATATTGG - Intronic
1037959139 8:23083594-23083616 ATAAGATTTCATATTTATTTTGG - Intergenic
1038371192 8:26993004-26993026 AAAATATTTATGATCTCTATGGG + Intergenic
1042435817 8:68763582-68763604 GTCATATTTTAGATCTATATAGG - Intronic
1042853855 8:73244545-73244567 ATAATATTTTAAAGCAATATAGG - Intronic
1043602687 8:81959994-81960016 ACAAAATATCAGATCTTTATAGG + Intergenic
1043962320 8:86431365-86431387 ATAATATTTAATAACTATTTAGG - Intronic
1046361777 8:113168676-113168698 ATTATATTTAAGCACTATATGGG + Intronic
1046371277 8:113310222-113310244 ATAATATTTCATATGTATTAAGG + Intronic
1046403123 8:113733757-113733779 TTAATAATTCTAATCTATATAGG - Intergenic
1046831286 8:118749627-118749649 AAAATTATTCTGATCTATATCGG + Intergenic
1047099299 8:121658539-121658561 ATAATATTTTAAATTTATTTTGG + Intergenic
1048617292 8:136091203-136091225 ATAATATTTTACATATTTATAGG - Intergenic
1049019421 8:139944766-139944788 TTAATATTTCAGGTATTTATTGG - Intronic
1050575885 9:6994786-6994808 ATAATTTATCACATTTATATTGG - Intronic
1051408547 9:16765341-16765363 ATAAGATTTAAGATCTATTTTGG + Intronic
1051769465 9:20560794-20560816 ATAATATTTTACATATTTATGGG + Intronic
1051882894 9:21858273-21858295 AAAATATCTCAGATGTATAATGG - Intronic
1052119901 9:24700969-24700991 TAAATATTTCAGCTTTATATGGG + Intergenic
1052121363 9:24721317-24721339 ATAAAATTTCATATCTACACTGG - Intergenic
1052620085 9:30897582-30897604 AAAATATTTAAGATCTATAAGGG - Intergenic
1055130739 9:72771282-72771304 ATAGTTTTTCAGATCTCTGTTGG + Intronic
1055569707 9:77604103-77604125 ATAAGACTTCAGAGCTATTTCGG + Intronic
1055846218 9:80566315-80566337 ATAATATTTCTACTGTATATTGG + Intergenic
1056644833 9:88401889-88401911 ATAATATTTTACATCTTTATGGG + Intronic
1057994181 9:99805137-99805159 ATAATAATTCATATTTGTATGGG - Intergenic
1058273904 9:103013320-103013342 ATAATATATTAAATATATATAGG - Intronic
1058589346 9:106546027-106546049 TTCATATTTCAGATATATTTTGG - Intergenic
1058622167 9:106895132-106895154 ATAATATTCCATACCTTTATTGG + Intronic
1060119824 9:120978459-120978481 ATAAAATTTAAGATCTAGAAGGG - Intronic
1060957594 9:127654181-127654203 CTAATATTTTGAATCTATATCGG - Intronic
1061024015 9:128035799-128035821 ATAATATTTTACATATTTATGGG - Intergenic
1186798618 X:13070620-13070642 ATAATATTTCATTTCCATGTAGG + Intergenic
1187767408 X:22658251-22658273 ATAATATTTTATATATTTATGGG - Intergenic
1188251045 X:27894819-27894841 ATGATATTTTATATATATATAGG - Intergenic
1188528719 X:31114147-31114169 ACAATATTTTACATCTTTATGGG - Intronic
1188682797 X:33031954-33031976 ATAATAATACTGATCTCTATTGG - Intronic
1188859146 X:35236071-35236093 ATAATATTTTACATATTTATGGG + Intergenic
1189700462 X:43713496-43713518 CTAGTATTCCACATCTATATGGG - Intronic
1190187832 X:48251298-48251320 ATAATTTTTCATTTTTATATTGG + Intronic
1190380090 X:49830581-49830603 TTTATATAACAGATCTATATTGG - Intronic
1190656714 X:52619065-52619087 ATAATTTTTCATTTTTATATTGG + Intergenic
1190662222 X:52665320-52665342 ATAATTTTTCATTTTTATATTGG - Intronic
1191154914 X:57264108-57264130 ATAATATTTCAGAAAAAAATAGG + Intergenic
1192724242 X:73730827-73730849 ATAATATTTTACATATTTATGGG + Intergenic
1192863259 X:75102066-75102088 ATAATATTTTACATATTTATGGG + Intronic
1193100079 X:77600907-77600929 AAAATATTTCTGATTTCTATTGG + Intronic
1193288535 X:79742975-79742997 ATAATATTTAAGTTAAATATTGG - Intergenic
1193519896 X:82516675-82516697 ATAATTTCTCATTTCTATATTGG - Intergenic
1193601846 X:83516352-83516374 ATCATATTTGTGAACTATATTGG + Intergenic
1193670521 X:84379223-84379245 ATAATATTTCAGATCTATATGGG - Intronic
1193692432 X:84662678-84662700 GTAAGTTTTCAGATGTATATAGG + Intergenic
1194063247 X:89230731-89230753 ATAATATTTTACATATTTATGGG - Intergenic
1194288691 X:92040991-92041013 ATAATATTTTACATATTTATGGG + Intronic
1194433921 X:93846969-93846991 ATAATATTTTATATATTTATGGG + Intergenic
1194658880 X:96606182-96606204 ATAATCTATCATAACTATATTGG - Intergenic
1195042889 X:101030436-101030458 AAAAGAATGCAGATCTATATAGG - Intronic
1196292921 X:113965107-113965129 ATAGTATTTCAGTTAAATATTGG - Intergenic
1196421489 X:115526596-115526618 ATAATATTTGACATATTTATGGG + Intergenic
1197329872 X:125140711-125140733 ATAATATTTTACATATTTATAGG - Intergenic
1197502849 X:127262984-127263006 ATAATATTTGATTTATATATTGG - Intergenic
1197876095 X:131108767-131108789 ATCATATGGCAGCTCTATATTGG + Intergenic
1198745348 X:139884346-139884368 ATAAACTGTCAGATCTACATGGG + Intronic
1199671709 X:150153171-150153193 AAAATGTTTCAGATCTGTGTTGG - Intergenic
1200015041 X:153154665-153154687 ATAAGATTGCAGATCTATGAAGG - Intergenic
1200023460 X:153232199-153232221 ATAATATTGCCAATCTATAAAGG + Intergenic
1200606212 Y:5265556-5265578 ATAATATTTTACATATTTATGGG + Intronic
1200717425 Y:6564854-6564876 ATAATATTTTACATATTTATGGG - Intergenic
1201369368 Y:13244511-13244533 ATAATATTTCCCATATATATGGG - Intergenic