ID: 1193671312

View in Genome Browser
Species Human (GRCh38)
Location X:84389770-84389792
Sequence TGTGCACTGGGCAGCTCCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 1, 2: 1, 3: 18, 4: 194}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193671312_1193671321 29 Left 1193671312 X:84389770-84389792 CCACCGGAGCTGCCCAGTGCACA 0: 1
1: 1
2: 1
3: 18
4: 194
Right 1193671321 X:84389822-84389844 GCATATCTCTACTTGTTCCATGG 0: 1
1: 0
2: 0
3: 7
4: 124
1193671312_1193671318 7 Left 1193671312 X:84389770-84389792 CCACCGGAGCTGCCCAGTGCACA 0: 1
1: 1
2: 1
3: 18
4: 194
Right 1193671318 X:84389800-84389822 CTGGCCTTTAAGCCGTTTAAAGG 0: 1
1: 0
2: 0
3: 5
4: 80
1193671312_1193671322 30 Left 1193671312 X:84389770-84389792 CCACCGGAGCTGCCCAGTGCACA 0: 1
1: 1
2: 1
3: 18
4: 194
Right 1193671322 X:84389823-84389845 CATATCTCTACTTGTTCCATGGG 0: 1
1: 0
2: 0
3: 11
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193671312 Original CRISPR TGTGCACTGGGCAGCTCCGG TGG (reversed) Intronic
901266472 1:7914293-7914315 TGTGCACCAGGGAGCTCCGCTGG - Intergenic
902727114 1:18344598-18344620 TGTGCACAGGACAGCTGTGGGGG + Intronic
903240656 1:21980727-21980749 TGTGCACTGTGCAACTCTAGAGG - Intronic
903244399 1:22005350-22005372 TGTGCACTGTGCAACTCTAGAGG - Intronic
903668187 1:25020810-25020832 TGTGCAATGGGCAGCAGGGGTGG - Intergenic
904752022 1:32746901-32746923 TGTGCAGTGGGCAGCGGCTGAGG + Intronic
905451590 1:38060394-38060416 CCTGCCCTGGGCAGCCCCGGGGG - Intergenic
905925929 1:41749790-41749812 TGTGCTCTACGGAGCTCCGGGGG + Intronic
906964663 1:50444458-50444480 TGTGTTCTGTGCAGCTCTGGGGG + Intronic
908422577 1:63973315-63973337 TATGCTCTGGGCAGCCCAGGGGG - Intronic
909936563 1:81557787-81557809 TGTTCTCTGGGCAGCTACAGGGG - Intronic
913061311 1:115211045-115211067 TGTGAAATGGCCAGCTCCAGTGG - Intergenic
914948403 1:152087316-152087338 TGTCCACTGACCATCTCCGGTGG + Exonic
915213419 1:154325806-154325828 TGTAGACTGGGGAGCACCGGGGG + Intronic
915555476 1:156658557-156658579 TGAGCCAGGGGCAGCTCCGGTGG - Exonic
916499032 1:165370607-165370629 TGTGCACTTGACAGCTCGAGTGG - Intergenic
916942473 1:169690147-169690169 TGTGCACTGTACACCTCCAGGGG + Intronic
919934359 1:202241728-202241750 TGGGTCCTGGGGAGCTCCGGTGG + Intronic
922594348 1:226802580-226802602 TGTCCACAGGGCAGCTCCCAGGG - Intergenic
1063211800 10:3887550-3887572 TGTGAGCTGGGCAGGTGCGGCGG + Intergenic
1066264132 10:33758815-33758837 TGTGCACTGCGCAACTCCATGGG + Intergenic
1066315430 10:34241375-34241397 TGAACACTGGGGAGCACCGGTGG + Intronic
1067371967 10:45692680-45692702 TGTACACTGGACAGCCCCTGTGG - Intergenic
1067387813 10:45833473-45833495 TGTACACTGGACAGCCCCTGTGG + Intronic
1067418310 10:46123791-46123813 TGTACACTGGACAGCCCCTGTGG - Intergenic
1067503668 10:46830375-46830397 TGTACACTGGACAGCCCCTGTGG - Intergenic
1067875451 10:50002617-50002639 TGTACACTGGACAGCCCCTGTGG - Intronic
1070159344 10:73856425-73856447 TGTCCACTGGGCAGCTACCCCGG + Intronic
1070250469 10:74768638-74768660 TGTGCCCTGGGCTGCTCTTGGGG - Intergenic
1070568364 10:77620869-77620891 TGTGCACTGCACAACTCCAGAGG + Intronic
1071394887 10:85213329-85213351 TGTGTGCTGGACAGCTCCAGAGG + Intergenic
1071607094 10:87002257-87002279 TGTACACTGGACAGCCCCTGTGG - Intergenic
1072661646 10:97367015-97367037 TGTGCACTGAGCAGGGGCGGGGG - Intronic
1073864330 10:107784738-107784760 TGTATACTGGGCAGCTCTGGTGG - Intergenic
1076117366 10:127909500-127909522 TGTCAAGTGGGCAGCTGCGGAGG - Intronic
1076199523 10:128547168-128547190 GGTGCTCTGGGCAGAGCCGGGGG - Intergenic
1077372742 11:2191135-2191157 TGTGCAGGGGGCAGAGCCGGGGG + Intergenic
1078102780 11:8339628-8339650 TGTGCACGGGTCAGCCCAGGAGG - Intergenic
1081539121 11:44017336-44017358 TGTGCACTGCACAACTCCAGGGG + Intergenic
1083655348 11:64226628-64226650 TCTGAACGGGGCAGCTCTGGGGG - Exonic
1084284490 11:68122173-68122195 TGTGCTCTGGGCAGTTGCGGCGG - Intergenic
1090409020 11:126495038-126495060 TGTGCACTGGCCAATTCCAGTGG + Intronic
1090672308 11:128957258-128957280 CGTGCACTGGGCAGCTGGGCAGG + Intergenic
1094682224 12:32677021-32677043 TGTGCACTACGCAACTCCAGTGG - Intergenic
1096512357 12:52138021-52138043 TGCTCACTGGGCAGCTTCAGGGG + Intergenic
1097359626 12:58644774-58644796 TGTGCACTTTGCAGCTCAGGAGG + Intronic
1099978645 12:89572505-89572527 TGTGCACTGGGAAGAGCCAGAGG - Intergenic
1101748103 12:107559405-107559427 TTTGCACTGGGCAGCTTCAAGGG - Intronic
1103707018 12:122880924-122880946 TGTGCACTGCCCAACTCCAGGGG + Intronic
1104270863 12:127281004-127281026 TGGGCACTGGGCAGGGCTGGAGG + Intergenic
1105338385 13:19496340-19496362 CGTGCATTGGCCAGCTCCAGTGG - Intronic
1107517539 13:41145718-41145740 TGTGCACTGGGAAGATGGGGTGG + Intergenic
1108633693 13:52311829-52311851 CATGCATTGGTCAGCTCCGGTGG - Intergenic
1108634105 13:52315530-52315552 CATGCATTGGTCAGCTCCGGTGG - Intergenic
1108928700 13:55787394-55787416 TCTGCACTGGCCAGGTGCGGTGG - Intergenic
1111040478 13:82740778-82740800 TGTGCAAAGGGCAGCTCCAGTGG - Intergenic
1113905263 13:113816535-113816557 TGTTCACTGAGCAGGGCCGGTGG - Exonic
1116283760 14:42945744-42945766 TGTTCACTGGGCAGCTCTAGTGG + Intergenic
1116292298 14:43059525-43059547 TGTGCACAGGGCAGTTCTGATGG - Intergenic
1119219625 14:72895213-72895235 TGGGCACCGGGAAGCTCTGGGGG + Intergenic
1121996459 14:98607081-98607103 TTTCCACTGGGCAACTCAGGAGG + Intergenic
1122922664 14:104886412-104886434 TGCTCACTGTCCAGCTCCGGTGG - Exonic
1123019347 14:105390363-105390385 TGAGCACTGGGAAGCTCCCGGGG - Intronic
1123943863 15:25229604-25229626 TGTGACCTGGGCAGTTCTGGAGG - Intergenic
1125594186 15:40873863-40873885 TGTGCACCGGGGAGCTGGGGCGG - Intronic
1127983243 15:64049539-64049561 TGTGCACTGGGAATCACCTGGGG - Intronic
1128243132 15:66115133-66115155 TGTGCCCTGGGCAGGGCGGGAGG - Intronic
1129018393 15:72490335-72490357 TGTGAACTGGGCAGCACAGCAGG + Intronic
1129932058 15:79419441-79419463 TGTCCACTGGCCAGCTGCGTGGG + Intronic
1131559768 15:93429517-93429539 TGTACACTGGACAGCCCCTGTGG + Intergenic
1132606814 16:797094-797116 TGTGGAATGGGCAGCTGTGGGGG + Intronic
1132610470 16:813539-813561 TGTGGACTGGGCAGCTCTCACGG + Exonic
1132956495 16:2597022-2597044 TGTGTCCTGAGCAGCTCCGAGGG + Intronic
1133356811 16:5142898-5142920 TCTGCACTGTGCACCTCCGCAGG + Intergenic
1134634597 16:15782810-15782832 GGTGCACTGCACAACTCCGGGGG - Intronic
1136008194 16:27345360-27345382 TGTCCACTGGTCAGCTGCTGCGG + Intronic
1136059810 16:27718743-27718765 AGTGCTCTGGGCAGCTGCGAGGG - Intronic
1136556201 16:31009394-31009416 AGTGCATTGGGCAGCTCAGCCGG + Intronic
1137813564 16:51376260-51376282 TGTGCACTGCACAACTCCAGGGG + Intergenic
1137869684 16:51937974-51937996 TGGTCACTGGGCAGCTCCCTGGG - Intergenic
1141032570 16:80602548-80602570 GGTGCACTGGGCAGGGCAGGTGG - Exonic
1141697763 16:85628171-85628193 TGTGCACTGGGCAGGCGGGGCGG - Intronic
1143089189 17:4438769-4438791 TGTGCACTGAGCAGCGACAGGGG + Intronic
1143180332 17:4980462-4980484 TGTGCCTTGGGGAGCTCTGGGGG + Exonic
1143389786 17:6553510-6553532 TGTGCACTGCACAACTCCAGGGG + Intronic
1147398513 17:40164039-40164061 TGGGACCTGGGAAGCTCCGGTGG + Exonic
1150320750 17:64212541-64212563 TGTGTACTAGCCAGCTCCCGGGG + Intronic
1151146495 17:72046485-72046507 TCTCCACTTGGCAGCTCAGGAGG - Intergenic
1151262668 17:72929041-72929063 TGTGCACTGGGAGGCTCTGTGGG - Intronic
1152282977 17:79396236-79396258 TTTGGACTGGGCAGAGCCGGGGG + Intronic
1152387233 17:79981889-79981911 TGCGCACAGGGAAGCCCCGGAGG - Intronic
1153581920 18:6582319-6582341 TGCACACTGGGCAACTCCAGGGG + Intronic
1158274926 18:55756851-55756873 TGTGCACTGCACAATTCCGGAGG - Intergenic
1160100372 18:75915282-75915304 TGTGCACTGGGCAACTTCCATGG - Intergenic
1161394415 19:4037666-4037688 GGTGCCCTGGGCAGCACGGGTGG + Exonic
1161516932 19:4701903-4701925 TGTGCTCTGGGCATCTATGGGGG - Intronic
1161642450 19:5432783-5432805 TGTCCCCTGGGGAGCTCAGGGGG + Intergenic
1163697340 19:18770489-18770511 TGTGCCCTGGGCAGGTCCCCTGG - Intronic
1165766056 19:38352011-38352033 TGTGCACTGCCCAACTCCAGGGG + Intronic
1166504143 19:43361095-43361117 TGGGGACTGGGCAGCTCCCAGGG - Intronic
1166506314 19:43373663-43373685 TGGGGACTGGGCAGCTCCCAGGG + Intergenic
1167402087 19:49279628-49279650 TGTGCTCTGAGCAGCCTCGGGGG + Intergenic
1167615414 19:50530253-50530275 AGGGCACTGGGGAGCCCCGGAGG - Intronic
925444267 2:3914419-3914441 TGAGCGCTGAGCAGCCCCGGGGG - Intergenic
926119829 2:10235910-10235932 TGTGTCCTGGACAGCTCCGGTGG + Intergenic
926149416 2:10416312-10416334 TGGGCACTGTGCAGTTCTGGGGG + Intronic
926459395 2:13110137-13110159 TTTGCACTGGTCAGCTCTGTGGG - Intergenic
927194984 2:20540790-20540812 GGTGCCCTGGGGAGCTCCAGGGG + Intergenic
927920800 2:26970780-26970802 AGTGCACGAGGCGGCTCCGGCGG - Exonic
930847151 2:55918442-55918464 TGTGCATTGGACAGCTTCGGGGG + Intronic
931198787 2:60077311-60077333 TGTGCCCAGGGAAGCTCCAGAGG - Intergenic
931571075 2:63669835-63669857 TGTGCACTGGACAAATCCTGGGG - Intronic
931686924 2:64801761-64801783 TGTGCACTGCACAACTCCAGAGG - Intergenic
932398400 2:71463500-71463522 TGTGCACTCTGCAGAGCCGGTGG - Intronic
932537997 2:72619890-72619912 TGTGTGCTGGGCAGCTCTGGTGG + Intronic
934637782 2:96006856-96006878 TGTGCTCTGCACAGCTCCAGGGG + Intergenic
942231420 2:173863887-173863909 TGTGCCCTGGGCAGGTCCCCTGG - Intergenic
946390747 2:219415612-219415634 TGTGAGCTGGGCAGCACCGCTGG - Intergenic
946729411 2:222694010-222694032 TGTGCACTGAACAACTCCAGGGG + Intronic
947804235 2:232954125-232954147 TGTGCACTGTCCAACTACGGGGG + Intronic
948200930 2:236129270-236129292 TGTCCACTGGGCAGGGCAGGGGG - Exonic
948289555 2:236815142-236815164 TTTGCACTGGGCAGCTTCCCCGG - Intergenic
948312648 2:237000152-237000174 TGGGAACTGGGCAGCTCCTGCGG + Intergenic
1169196498 20:3685701-3685723 GATGCACCGAGCAGCTCCGGGGG + Intergenic
1171035261 20:21708504-21708526 TGTGCCCAGGGCAGATTCGGAGG + Intronic
1173229487 20:41183039-41183061 AGTGCACTAGGCAGCTGGGGCGG - Exonic
1174537699 20:51265296-51265318 TGTGTCCTGGGCAGCTCTAGGGG - Intergenic
1175187933 20:57191278-57191300 TGTGCTCTGGGGTGCTCCAGAGG + Intronic
1175943628 20:62549027-62549049 TCTGCACTGGGCAGGTGCAGGGG + Intergenic
1176614609 21:9017404-9017426 TCTGCCCAGGGCAGCTCAGGGGG - Intergenic
1176735163 21:10539542-10539564 CGTGCATTGGCCAGCTCCAGTGG + Intronic
1178771460 21:35508619-35508641 TGTGCACTGCACAGCTCCAGGGG - Intronic
1178948471 21:36966846-36966868 TGTGTGATGGGGAGCTCCGGAGG + Intronic
1180877403 22:19181039-19181061 TGCCCACTGGGAAGCTCTGGGGG - Intronic
1180990368 22:19932206-19932228 TGTGCACTGGCCAGCTGTGAGGG - Intronic
1181847845 22:25726954-25726976 TGTGCACTTTGCAGCCCCCGAGG + Exonic
1182088116 22:27575375-27575397 TGAGCACTGGGCAGAACCCGGGG - Intergenic
1183933439 22:41248826-41248848 TGGGCATTTGGCAGCTCCCGTGG + Intronic
950089977 3:10288496-10288518 TGGGTACTGGGCAGCTCCTCTGG + Intronic
950579008 3:13850694-13850716 AGTGCACCAGGGAGCTCCGGGGG - Intronic
950702058 3:14757595-14757617 CCAGCACTGGGCAGCTCCAGTGG + Exonic
959007992 3:101042264-101042286 GGTGCACTGGGCAGGTGCTGGGG + Intergenic
963780536 3:149481850-149481872 TGTGCACTGAGCAGCTGCGAGGG + Intronic
965469169 3:169069199-169069221 TGTGCACTGGACAGTTTTGGAGG + Intergenic
967689072 3:192452668-192452690 TGTGCACTGAACAACTCCAGAGG - Intronic
968584368 4:1409272-1409294 GGTGCCCTGTGTAGCTCCGGGGG - Intergenic
968662195 4:1803283-1803305 TGGGCACCGGGCACCTCCTGTGG - Intronic
969703752 4:8781285-8781307 TGGCCACTGGACAGCTCCCGTGG + Intergenic
971352419 4:25865235-25865257 TGTGGACTGGGCACCACCTGAGG + Intronic
971779659 4:31016491-31016513 TGTGCATTGAGCAACTCCAGGGG + Intronic
977564004 4:98563050-98563072 TGTGCACTGCACAACTCCTGGGG + Intronic
982160545 4:152564578-152564600 TATGCACTGCACAGCTCCAGGGG + Intergenic
983131250 4:164022665-164022687 TGTGCATGGAGCAGCTGCGGCGG + Intronic
984704406 4:182837201-182837223 GGTGCTCTGAGCAGCTCAGGTGG - Intergenic
985698967 5:1358999-1359021 TGTGCACTGAGCAGCCCCATGGG + Intergenic
987220184 5:15783282-15783304 AGTGCACTGGGCAGCTAGGAGGG + Intronic
988166070 5:27590868-27590890 TGGGCACTAGGCAGCTCTGGTGG - Intergenic
988238327 5:28575462-28575484 TGAGCATGGGGAAGCTCCGGTGG + Intergenic
988585973 5:32507863-32507885 TGTGCACTGGGAGGATCGGGTGG - Intergenic
991232042 5:64345271-64345293 TGTGCACTGCGGAGCTCCAGAGG - Intronic
992597154 5:78358930-78358952 CGGGCACTGGGCAGCTGCTGAGG + Intergenic
992957451 5:81924547-81924569 TGTGCACTGCCCAGCTCTGGAGG - Intergenic
995829202 5:116334781-116334803 TGTGGACTGGGCAGCTGCACAGG - Intronic
997883725 5:137612742-137612764 TGTGCACTTGGCATCTACTGAGG - Intergenic
1003878713 6:10461475-10461497 TTTGCACTGGGCAGCTACAATGG + Intergenic
1005219177 6:23566452-23566474 TGTGCACTGGGAAGAACCTGGGG - Intergenic
1005782137 6:29203037-29203059 TGTGTGCTGGGCAGCTTTGGTGG - Intergenic
1005843936 6:29763044-29763066 TGTGGACTGTGCTGCTCTGGAGG + Intergenic
1005873553 6:29994935-29994957 TGTGGACTGTGCTGCTCTGGAGG + Intergenic
1007406642 6:41639367-41639389 TGTGCACAGGGCAGGGGCGGCGG - Intronic
1007615912 6:43179741-43179763 TGTGCACTGGGCAGGTTCCTGGG + Exonic
1007705799 6:43790451-43790473 GGAGCACTGGGTAGCTCCAGAGG - Intergenic
1007978795 6:46129658-46129680 TGTGCACCTGGCAGCTTAGGTGG - Intergenic
1010425253 6:75722377-75722399 TGGGCACTGGCCAGGTGCGGTGG - Intergenic
1018631959 6:165829237-165829259 TGTGCCCAGGGCAGCTCCACTGG - Intronic
1018918571 6:168154650-168154672 TGTGCACAGGGCAGCACCTGTGG + Intergenic
1018964606 6:168474683-168474705 TGTGCACTGCACAACTCCAGGGG + Intronic
1020049120 7:5070345-5070367 TGTGAAATGGGCACTTCCGGTGG - Intronic
1020898659 7:13974971-13974993 TGTCCAATGGACAGCTTCGGAGG + Intronic
1022101839 7:27173687-27173709 TGCGCCCTGGGCACCTCCAGCGG - Exonic
1024452466 7:49563653-49563675 TGTGTGCAGGGCAGCTCTGGTGG + Intergenic
1024980581 7:55154363-55154385 TGTGCACTGAGCAGCCCCCATGG - Intronic
1028885321 7:95926039-95926061 TGTGCATTAAGCAGCTCCAGAGG + Intronic
1030440566 7:109583841-109583863 TGTTCACTGGGCAGCTCCAGTGG + Intergenic
1032742893 7:134757289-134757311 TGTGCACTGCACAACTCCAGGGG - Intronic
1038427669 8:27474675-27474697 TGTGAACAGAGCAGCTCCAGTGG - Intronic
1038646813 8:29368959-29368981 TGTGCAATGGTCAGCTCAGCAGG + Intergenic
1039037199 8:33372747-33372769 TGGGCTCTGGGCAACTCAGGTGG + Exonic
1045362731 8:101448309-101448331 TGTGCACTGAGTAACTCCAGGGG - Intergenic
1045426205 8:102068250-102068272 GGTGCACTGGGCAGCCAAGGAGG - Intronic
1046810446 8:118527294-118527316 TGTGCTGTGGGAAGCTCCTGTGG - Intronic
1047286954 8:123495634-123495656 TGTGGACTGGGCGGGTGCGGGGG + Intergenic
1047296099 8:123571795-123571817 TGTGCACTGCACAACTCAGGAGG + Intergenic
1048195650 8:132329876-132329898 TGTGCACTGAACAACTCCAGGGG - Intronic
1049256286 8:141615651-141615673 TGTGCACTGTGGAACTGCGGTGG + Intergenic
1049521607 8:143094313-143094335 TGAGCCCTGGGCAGGTCGGGAGG + Intergenic
1052492031 9:29181987-29182009 TGTGTACTATGCAGCTCCAGGGG - Intergenic
1052956292 9:34255454-34255476 TGGGAAATGGGCAGCTCCTGTGG - Intronic
1059440658 9:114304993-114305015 TGAGCACTGGGAAGCTGCTGCGG - Intronic
1059750480 9:117242795-117242817 TTTGCTCTGGGCAGCTCCCAGGG - Intronic
1061326050 9:129865387-129865409 TGTCCCCTGGGCAGCTCAGATGG - Intronic
1061965306 9:134010474-134010496 AGTGCACAGGTCAGCTCTGGAGG - Intergenic
1062367405 9:136217609-136217631 TGTGCTCTGGGCAACTCCTGAGG - Intronic
1062424774 9:136501007-136501029 TGTCCACTGAGCAGCCCAGGCGG - Intronic
1186671418 X:11770919-11770941 TGTGCACTGGGCAGGTGCTGGGG + Intronic
1190056940 X:47186504-47186526 GGTGCACGGGGCAGCTCCTACGG + Exonic
1191696391 X:63995001-63995023 TGTGCACTGGTCAACTTCAGGGG - Intergenic
1192442187 X:71182731-71182753 TCTGCAGTGGGCACCTGCGGTGG + Intergenic
1193671312 X:84389770-84389792 TGTGCACTGGGCAGCTCCGGTGG - Intronic
1195179542 X:102343592-102343614 TGTACTCTGGGCAGATCCAGTGG - Intergenic
1199016237 X:142819525-142819547 TGTGCACTGGGCAGCTCCAGTGG + Intergenic
1199565117 X:149207689-149207711 TGTGCACTGTACAGCTCTAGGGG - Intergenic
1199615848 X:149654857-149654879 TGTGGACAAGGCAGCTTCGGAGG - Intergenic
1199626793 X:149748391-149748413 TGTGGACAAGGCAGCTTCGGAGG + Intergenic
1200119796 X:153784864-153784886 TGGGCACAGGGCAGCCCGGGCGG - Intronic