ID: 1193675970

View in Genome Browser
Species Human (GRCh38)
Location X:84453363-84453385
Sequence CACATGGATCCTGCTGGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193675970_1193675976 5 Left 1193675970 X:84453363-84453385 CCAACCCCAGCAGGATCCATGTG No data
Right 1193675976 X:84453391-84453413 GAGAAAAAGTCTGTGCACTTAGG No data
1193675970_1193675979 11 Left 1193675970 X:84453363-84453385 CCAACCCCAGCAGGATCCATGTG No data
Right 1193675979 X:84453397-84453419 AAGTCTGTGCACTTAGGGGAAGG No data
1193675970_1193675977 6 Left 1193675970 X:84453363-84453385 CCAACCCCAGCAGGATCCATGTG No data
Right 1193675977 X:84453392-84453414 AGAAAAAGTCTGTGCACTTAGGG No data
1193675970_1193675981 30 Left 1193675970 X:84453363-84453385 CCAACCCCAGCAGGATCCATGTG No data
Right 1193675981 X:84453416-84453438 AAGGAGAGTACAGTGATTGTGGG No data
1193675970_1193675980 29 Left 1193675970 X:84453363-84453385 CCAACCCCAGCAGGATCCATGTG No data
Right 1193675980 X:84453415-84453437 GAAGGAGAGTACAGTGATTGTGG No data
1193675970_1193675978 7 Left 1193675970 X:84453363-84453385 CCAACCCCAGCAGGATCCATGTG No data
Right 1193675978 X:84453393-84453415 GAAAAAGTCTGTGCACTTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193675970 Original CRISPR CACATGGATCCTGCTGGGGT TGG (reversed) Intronic