ID: 1193675972

View in Genome Browser
Species Human (GRCh38)
Location X:84453367-84453389
Sequence GCACCACATGGATCCTGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193675972_1193675979 7 Left 1193675972 X:84453367-84453389 CCCCAGCAGGATCCATGTGGTGC No data
Right 1193675979 X:84453397-84453419 AAGTCTGTGCACTTAGGGGAAGG No data
1193675972_1193675976 1 Left 1193675972 X:84453367-84453389 CCCCAGCAGGATCCATGTGGTGC No data
Right 1193675976 X:84453391-84453413 GAGAAAAAGTCTGTGCACTTAGG No data
1193675972_1193675977 2 Left 1193675972 X:84453367-84453389 CCCCAGCAGGATCCATGTGGTGC No data
Right 1193675977 X:84453392-84453414 AGAAAAAGTCTGTGCACTTAGGG No data
1193675972_1193675978 3 Left 1193675972 X:84453367-84453389 CCCCAGCAGGATCCATGTGGTGC No data
Right 1193675978 X:84453393-84453415 GAAAAAGTCTGTGCACTTAGGGG No data
1193675972_1193675981 26 Left 1193675972 X:84453367-84453389 CCCCAGCAGGATCCATGTGGTGC No data
Right 1193675981 X:84453416-84453438 AAGGAGAGTACAGTGATTGTGGG No data
1193675972_1193675980 25 Left 1193675972 X:84453367-84453389 CCCCAGCAGGATCCATGTGGTGC No data
Right 1193675980 X:84453415-84453437 GAAGGAGAGTACAGTGATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193675972 Original CRISPR GCACCACATGGATCCTGCTG GGG (reversed) Intronic