ID: 1193675973

View in Genome Browser
Species Human (GRCh38)
Location X:84453368-84453390
Sequence TGCACCACATGGATCCTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193675973_1193675978 2 Left 1193675973 X:84453368-84453390 CCCAGCAGGATCCATGTGGTGCA No data
Right 1193675978 X:84453393-84453415 GAAAAAGTCTGTGCACTTAGGGG No data
1193675973_1193675981 25 Left 1193675973 X:84453368-84453390 CCCAGCAGGATCCATGTGGTGCA No data
Right 1193675981 X:84453416-84453438 AAGGAGAGTACAGTGATTGTGGG No data
1193675973_1193675976 0 Left 1193675973 X:84453368-84453390 CCCAGCAGGATCCATGTGGTGCA No data
Right 1193675976 X:84453391-84453413 GAGAAAAAGTCTGTGCACTTAGG No data
1193675973_1193675980 24 Left 1193675973 X:84453368-84453390 CCCAGCAGGATCCATGTGGTGCA No data
Right 1193675980 X:84453415-84453437 GAAGGAGAGTACAGTGATTGTGG No data
1193675973_1193675977 1 Left 1193675973 X:84453368-84453390 CCCAGCAGGATCCATGTGGTGCA No data
Right 1193675977 X:84453392-84453414 AGAAAAAGTCTGTGCACTTAGGG No data
1193675973_1193675979 6 Left 1193675973 X:84453368-84453390 CCCAGCAGGATCCATGTGGTGCA No data
Right 1193675979 X:84453397-84453419 AAGTCTGTGCACTTAGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193675973 Original CRISPR TGCACCACATGGATCCTGCT GGG (reversed) Intronic