ID: 1193675974

View in Genome Browser
Species Human (GRCh38)
Location X:84453369-84453391
Sequence CTGCACCACATGGATCCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193675974_1193675978 1 Left 1193675974 X:84453369-84453391 CCAGCAGGATCCATGTGGTGCAG No data
Right 1193675978 X:84453393-84453415 GAAAAAGTCTGTGCACTTAGGGG No data
1193675974_1193675980 23 Left 1193675974 X:84453369-84453391 CCAGCAGGATCCATGTGGTGCAG No data
Right 1193675980 X:84453415-84453437 GAAGGAGAGTACAGTGATTGTGG No data
1193675974_1193675976 -1 Left 1193675974 X:84453369-84453391 CCAGCAGGATCCATGTGGTGCAG No data
Right 1193675976 X:84453391-84453413 GAGAAAAAGTCTGTGCACTTAGG No data
1193675974_1193675981 24 Left 1193675974 X:84453369-84453391 CCAGCAGGATCCATGTGGTGCAG No data
Right 1193675981 X:84453416-84453438 AAGGAGAGTACAGTGATTGTGGG No data
1193675974_1193675979 5 Left 1193675974 X:84453369-84453391 CCAGCAGGATCCATGTGGTGCAG No data
Right 1193675979 X:84453397-84453419 AAGTCTGTGCACTTAGGGGAAGG No data
1193675974_1193675977 0 Left 1193675974 X:84453369-84453391 CCAGCAGGATCCATGTGGTGCAG No data
Right 1193675977 X:84453392-84453414 AGAAAAAGTCTGTGCACTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193675974 Original CRISPR CTGCACCACATGGATCCTGC TGG (reversed) Intronic