ID: 1193675975

View in Genome Browser
Species Human (GRCh38)
Location X:84453379-84453401
Sequence GACTTTTTCTCTGCACCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193675975_1193675977 -10 Left 1193675975 X:84453379-84453401 CCATGTGGTGCAGAGAAAAAGTC No data
Right 1193675977 X:84453392-84453414 AGAAAAAGTCTGTGCACTTAGGG No data
1193675975_1193675979 -5 Left 1193675975 X:84453379-84453401 CCATGTGGTGCAGAGAAAAAGTC No data
Right 1193675979 X:84453397-84453419 AAGTCTGTGCACTTAGGGGAAGG No data
1193675975_1193675981 14 Left 1193675975 X:84453379-84453401 CCATGTGGTGCAGAGAAAAAGTC No data
Right 1193675981 X:84453416-84453438 AAGGAGAGTACAGTGATTGTGGG No data
1193675975_1193675978 -9 Left 1193675975 X:84453379-84453401 CCATGTGGTGCAGAGAAAAAGTC No data
Right 1193675978 X:84453393-84453415 GAAAAAGTCTGTGCACTTAGGGG No data
1193675975_1193675980 13 Left 1193675975 X:84453379-84453401 CCATGTGGTGCAGAGAAAAAGTC No data
Right 1193675980 X:84453415-84453437 GAAGGAGAGTACAGTGATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193675975 Original CRISPR GACTTTTTCTCTGCACCACA TGG (reversed) Intronic