ID: 1193675978

View in Genome Browser
Species Human (GRCh38)
Location X:84453393-84453415
Sequence GAAAAAGTCTGTGCACTTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193675968_1193675978 9 Left 1193675968 X:84453361-84453383 CCCCAACCCCAGCAGGATCCATG No data
Right 1193675978 X:84453393-84453415 GAAAAAGTCTGTGCACTTAGGGG No data
1193675964_1193675978 18 Left 1193675964 X:84453352-84453374 CCATACCTCCCCCAACCCCAGCA No data
Right 1193675978 X:84453393-84453415 GAAAAAGTCTGTGCACTTAGGGG No data
1193675972_1193675978 3 Left 1193675972 X:84453367-84453389 CCCCAGCAGGATCCATGTGGTGC No data
Right 1193675978 X:84453393-84453415 GAAAAAGTCTGTGCACTTAGGGG No data
1193675969_1193675978 8 Left 1193675969 X:84453362-84453384 CCCAACCCCAGCAGGATCCATGT No data
Right 1193675978 X:84453393-84453415 GAAAAAGTCTGTGCACTTAGGGG No data
1193675970_1193675978 7 Left 1193675970 X:84453363-84453385 CCAACCCCAGCAGGATCCATGTG No data
Right 1193675978 X:84453393-84453415 GAAAAAGTCTGTGCACTTAGGGG No data
1193675975_1193675978 -9 Left 1193675975 X:84453379-84453401 CCATGTGGTGCAGAGAAAAAGTC No data
Right 1193675978 X:84453393-84453415 GAAAAAGTCTGTGCACTTAGGGG No data
1193675974_1193675978 1 Left 1193675974 X:84453369-84453391 CCAGCAGGATCCATGTGGTGCAG No data
Right 1193675978 X:84453393-84453415 GAAAAAGTCTGTGCACTTAGGGG No data
1193675973_1193675978 2 Left 1193675973 X:84453368-84453390 CCCAGCAGGATCCATGTGGTGCA No data
Right 1193675978 X:84453393-84453415 GAAAAAGTCTGTGCACTTAGGGG No data
1193675966_1193675978 13 Left 1193675966 X:84453357-84453379 CCTCCCCCAACCCCAGCAGGATC No data
Right 1193675978 X:84453393-84453415 GAAAAAGTCTGTGCACTTAGGGG No data
1193675967_1193675978 10 Left 1193675967 X:84453360-84453382 CCCCCAACCCCAGCAGGATCCAT No data
Right 1193675978 X:84453393-84453415 GAAAAAGTCTGTGCACTTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193675978 Original CRISPR GAAAAAGTCTGTGCACTTAG GGG Intronic