ID: 1193675981

View in Genome Browser
Species Human (GRCh38)
Location X:84453416-84453438
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193675973_1193675981 25 Left 1193675973 X:84453368-84453390 CCCAGCAGGATCCATGTGGTGCA No data
Right 1193675981 X:84453416-84453438 AAGGAGAGTACAGTGATTGTGGG No data
1193675972_1193675981 26 Left 1193675972 X:84453367-84453389 CCCCAGCAGGATCCATGTGGTGC No data
Right 1193675981 X:84453416-84453438 AAGGAGAGTACAGTGATTGTGGG No data
1193675970_1193675981 30 Left 1193675970 X:84453363-84453385 CCAACCCCAGCAGGATCCATGTG No data
Right 1193675981 X:84453416-84453438 AAGGAGAGTACAGTGATTGTGGG No data
1193675974_1193675981 24 Left 1193675974 X:84453369-84453391 CCAGCAGGATCCATGTGGTGCAG No data
Right 1193675981 X:84453416-84453438 AAGGAGAGTACAGTGATTGTGGG No data
1193675975_1193675981 14 Left 1193675975 X:84453379-84453401 CCATGTGGTGCAGAGAAAAAGTC No data
Right 1193675981 X:84453416-84453438 AAGGAGAGTACAGTGATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type