ID: 1193681027

View in Genome Browser
Species Human (GRCh38)
Location X:84518936-84518958
Sequence GTGTGCAGACTCCACAGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193681027_1193681041 29 Left 1193681027 X:84518936-84518958 CCCCACCTGTGGAGTCTGCACAC No data
Right 1193681041 X:84518988-84519010 CAGGAGACTTCTCATTTCATTGG No data
1193681027_1193681034 10 Left 1193681027 X:84518936-84518958 CCCCACCTGTGGAGTCTGCACAC No data
Right 1193681034 X:84518969-84518991 CCCTCCCCTGTGTTCCGGCCAGG No data
1193681027_1193681032 5 Left 1193681027 X:84518936-84518958 CCCCACCTGTGGAGTCTGCACAC No data
Right 1193681032 X:84518964-84518986 TAATGCCCTCCCCTGTGTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193681027 Original CRISPR GTGTGCAGACTCCACAGGTG GGG (reversed) Intergenic