ID: 1193681029

View in Genome Browser
Species Human (GRCh38)
Location X:84518938-84518960
Sequence CAGTGTGCAGACTCCACAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193681029_1193681034 8 Left 1193681029 X:84518938-84518960 CCACCTGTGGAGTCTGCACACTG No data
Right 1193681034 X:84518969-84518991 CCCTCCCCTGTGTTCCGGCCAGG No data
1193681029_1193681041 27 Left 1193681029 X:84518938-84518960 CCACCTGTGGAGTCTGCACACTG No data
Right 1193681041 X:84518988-84519010 CAGGAGACTTCTCATTTCATTGG No data
1193681029_1193681032 3 Left 1193681029 X:84518938-84518960 CCACCTGTGGAGTCTGCACACTG No data
Right 1193681032 X:84518964-84518986 TAATGCCCTCCCCTGTGTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193681029 Original CRISPR CAGTGTGCAGACTCCACAGG TGG (reversed) Intergenic