ID: 1193681032

View in Genome Browser
Species Human (GRCh38)
Location X:84518964-84518986
Sequence TAATGCCCTCCCCTGTGTTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193681028_1193681032 4 Left 1193681028 X:84518937-84518959 CCCACCTGTGGAGTCTGCACACT No data
Right 1193681032 X:84518964-84518986 TAATGCCCTCCCCTGTGTTCCGG No data
1193681031_1193681032 0 Left 1193681031 X:84518941-84518963 CCTGTGGAGTCTGCACACTGGAT No data
Right 1193681032 X:84518964-84518986 TAATGCCCTCCCCTGTGTTCCGG No data
1193681029_1193681032 3 Left 1193681029 X:84518938-84518960 CCACCTGTGGAGTCTGCACACTG No data
Right 1193681032 X:84518964-84518986 TAATGCCCTCCCCTGTGTTCCGG No data
1193681027_1193681032 5 Left 1193681027 X:84518936-84518958 CCCCACCTGTGGAGTCTGCACAC No data
Right 1193681032 X:84518964-84518986 TAATGCCCTCCCCTGTGTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193681032 Original CRISPR TAATGCCCTCCCCTGTGTTC CGG Intergenic