ID: 1193681034

View in Genome Browser
Species Human (GRCh38)
Location X:84518969-84518991
Sequence CCCTCCCCTGTGTTCCGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193681029_1193681034 8 Left 1193681029 X:84518938-84518960 CCACCTGTGGAGTCTGCACACTG No data
Right 1193681034 X:84518969-84518991 CCCTCCCCTGTGTTCCGGCCAGG No data
1193681027_1193681034 10 Left 1193681027 X:84518936-84518958 CCCCACCTGTGGAGTCTGCACAC 0: 27
1: 60
2: 127
3: 157
4: 295
Right 1193681034 X:84518969-84518991 CCCTCCCCTGTGTTCCGGCCAGG No data
1193681031_1193681034 5 Left 1193681031 X:84518941-84518963 CCTGTGGAGTCTGCACACTGGAT 0: 41
1: 86
2: 119
3: 131
4: 248
Right 1193681034 X:84518969-84518991 CCCTCCCCTGTGTTCCGGCCAGG No data
1193681028_1193681034 9 Left 1193681028 X:84518937-84518959 CCCACCTGTGGAGTCTGCACACT No data
Right 1193681034 X:84518969-84518991 CCCTCCCCTGTGTTCCGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193681034 Original CRISPR CCCTCCCCTGTGTTCCGGCC AGG Intergenic
No off target data available for this crispr