ID: 1193681041

View in Genome Browser
Species Human (GRCh38)
Location X:84518988-84519010
Sequence CAGGAGACTTCTCATTTCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193681033_1193681041 -4 Left 1193681033 X:84518969-84518991 CCCTCCCCTGTGTTCCGGCCAGG No data
Right 1193681041 X:84518988-84519010 CAGGAGACTTCTCATTTCATTGG No data
1193681028_1193681041 28 Left 1193681028 X:84518937-84518959 CCCACCTGTGGAGTCTGCACACT No data
Right 1193681041 X:84518988-84519010 CAGGAGACTTCTCATTTCATTGG No data
1193681027_1193681041 29 Left 1193681027 X:84518936-84518958 CCCCACCTGTGGAGTCTGCACAC No data
Right 1193681041 X:84518988-84519010 CAGGAGACTTCTCATTTCATTGG No data
1193681037_1193681041 -9 Left 1193681037 X:84518974-84518996 CCCTGTGTTCCGGCCAGGAGACT No data
Right 1193681041 X:84518988-84519010 CAGGAGACTTCTCATTTCATTGG No data
1193681038_1193681041 -10 Left 1193681038 X:84518975-84518997 CCTGTGTTCCGGCCAGGAGACTT No data
Right 1193681041 X:84518988-84519010 CAGGAGACTTCTCATTTCATTGG No data
1193681029_1193681041 27 Left 1193681029 X:84518938-84518960 CCACCTGTGGAGTCTGCACACTG No data
Right 1193681041 X:84518988-84519010 CAGGAGACTTCTCATTTCATTGG No data
1193681035_1193681041 -5 Left 1193681035 X:84518970-84518992 CCTCCCCTGTGTTCCGGCCAGGA No data
Right 1193681041 X:84518988-84519010 CAGGAGACTTCTCATTTCATTGG No data
1193681036_1193681041 -8 Left 1193681036 X:84518973-84518995 CCCCTGTGTTCCGGCCAGGAGAC No data
Right 1193681041 X:84518988-84519010 CAGGAGACTTCTCATTTCATTGG No data
1193681031_1193681041 24 Left 1193681031 X:84518941-84518963 CCTGTGGAGTCTGCACACTGGAT No data
Right 1193681041 X:84518988-84519010 CAGGAGACTTCTCATTTCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193681041 Original CRISPR CAGGAGACTTCTCATTTCAT TGG Intergenic