ID: 1193686972

View in Genome Browser
Species Human (GRCh38)
Location X:84589146-84589168
Sequence ACCCATTTGCTGAAAATAAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193686970_1193686972 -3 Left 1193686970 X:84589126-84589148 CCCATCTCATATGTAATGATACC No data
Right 1193686972 X:84589146-84589168 ACCCATTTGCTGAAAATAAACGG No data
1193686971_1193686972 -4 Left 1193686971 X:84589127-84589149 CCATCTCATATGTAATGATACCC No data
Right 1193686972 X:84589146-84589168 ACCCATTTGCTGAAAATAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193686972 Original CRISPR ACCCATTTGCTGAAAATAAA CGG Intergenic
No off target data available for this crispr