ID: 1193689408

View in Genome Browser
Species Human (GRCh38)
Location X:84622455-84622477
Sequence GTGGAGTAAAGCACTGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193689403_1193689408 1 Left 1193689403 X:84622431-84622453 CCAGGCTACCAGAAAAGTAACTA No data
Right 1193689408 X:84622455-84622477 GTGGAGTAAAGCACTGAGGCTGG No data
1193689402_1193689408 2 Left 1193689402 X:84622430-84622452 CCCAGGCTACCAGAAAAGTAACT No data
Right 1193689408 X:84622455-84622477 GTGGAGTAAAGCACTGAGGCTGG No data
1193689401_1193689408 13 Left 1193689401 X:84622419-84622441 CCTGATGTGCTCCCAGGCTACCA No data
Right 1193689408 X:84622455-84622477 GTGGAGTAAAGCACTGAGGCTGG No data
1193689406_1193689408 -7 Left 1193689406 X:84622439-84622461 CCAGAAAAGTAACTAGGTGGAGT No data
Right 1193689408 X:84622455-84622477 GTGGAGTAAAGCACTGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193689408 Original CRISPR GTGGAGTAAAGCACTGAGGC TGG Intergenic
No off target data available for this crispr