ID: 1193693629

View in Genome Browser
Species Human (GRCh38)
Location X:84680094-84680116
Sequence TAGTGATTACTTTGGATCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193693623_1193693629 25 Left 1193693623 X:84680046-84680068 CCAATGTGGCACAGTGATAATGT No data
Right 1193693629 X:84680094-84680116 TAGTGATTACTTTGGATCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193693629 Original CRISPR TAGTGATTACTTTGGATCCT GGG Intergenic
No off target data available for this crispr