ID: 1193698693

View in Genome Browser
Species Human (GRCh38)
Location X:84739190-84739212
Sequence GTGGAGAGATGGATGGTCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193698693_1193698702 6 Left 1193698693 X:84739190-84739212 CCCTTGACCATCCATCTCTCCAC No data
Right 1193698702 X:84739219-84739241 AAGACCCAGCGCTGGGCCAAGGG 0: 10
1: 5
2: 9
3: 15
4: 201
1193698693_1193698701 5 Left 1193698693 X:84739190-84739212 CCCTTGACCATCCATCTCTCCAC No data
Right 1193698701 X:84739218-84739240 AAAGACCCAGCGCTGGGCCAAGG 0: 8
1: 5
2: 8
3: 21
4: 200
1193698693_1193698699 -1 Left 1193698693 X:84739190-84739212 CCCTTGACCATCCATCTCTCCAC No data
Right 1193698699 X:84739212-84739234 CTTCCAAAAGACCCAGCGCTGGG No data
1193698693_1193698698 -2 Left 1193698693 X:84739190-84739212 CCCTTGACCATCCATCTCTCCAC No data
Right 1193698698 X:84739211-84739233 ACTTCCAAAAGACCCAGCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193698693 Original CRISPR GTGGAGAGATGGATGGTCAA GGG (reversed) Intergenic
No off target data available for this crispr