ID: 1193701141

View in Genome Browser
Species Human (GRCh38)
Location X:84762416-84762438
Sequence ATATATAAGCTATGGAAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193701139_1193701141 -9 Left 1193701139 X:84762402-84762424 CCTTTTTCACTTGGATATATAAG No data
Right 1193701141 X:84762416-84762438 ATATATAAGCTATGGAAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193701141 Original CRISPR ATATATAAGCTATGGAAGAG AGG Intergenic
No off target data available for this crispr