ID: 1193710080

View in Genome Browser
Species Human (GRCh38)
Location X:84869166-84869188
Sequence AAGGATTCCCTATGAATAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193710078_1193710080 1 Left 1193710078 X:84869142-84869164 CCTGACAAAAACAAGCAATAGAG 0: 16
1: 431
2: 4665
3: 12044
4: 4564
Right 1193710080 X:84869166-84869188 AAGGATTCCCTATGAATAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193710080 Original CRISPR AAGGATTCCCTATGAATAAA TGG Intergenic
No off target data available for this crispr