ID: 1193710890

View in Genome Browser
Species Human (GRCh38)
Location X:84878363-84878385
Sequence CTTAATATGCCAATGAACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193710890_1193710892 21 Left 1193710890 X:84878363-84878385 CCATTGTTCATTGGCATATTAAG No data
Right 1193710892 X:84878407-84878429 AAATGACTGACTTTATATAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193710890 Original CRISPR CTTAATATGCCAATGAACAA TGG (reversed) Intergenic
No off target data available for this crispr