ID: 1193715136

View in Genome Browser
Species Human (GRCh38)
Location X:84928056-84928078
Sequence TGTCAGCTGCAGGATATGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193715121_1193715136 25 Left 1193715121 X:84928008-84928030 CCCACCCCTCCCTCTAGGAGCAC No data
Right 1193715136 X:84928056-84928078 TGTCAGCTGCAGGATATGGGTGG No data
1193715126_1193715136 16 Left 1193715126 X:84928017-84928039 CCCTCTAGGAGCACTGACGAAGG No data
Right 1193715136 X:84928056-84928078 TGTCAGCTGCAGGATATGGGTGG No data
1193715125_1193715136 19 Left 1193715125 X:84928014-84928036 CCTCCCTCTAGGAGCACTGACGA No data
Right 1193715136 X:84928056-84928078 TGTCAGCTGCAGGATATGGGTGG No data
1193715122_1193715136 24 Left 1193715122 X:84928009-84928031 CCACCCCTCCCTCTAGGAGCACT No data
Right 1193715136 X:84928056-84928078 TGTCAGCTGCAGGATATGGGTGG No data
1193715124_1193715136 20 Left 1193715124 X:84928013-84928035 CCCTCCCTCTAGGAGCACTGACG No data
Right 1193715136 X:84928056-84928078 TGTCAGCTGCAGGATATGGGTGG No data
1193715128_1193715136 15 Left 1193715128 X:84928018-84928040 CCTCTAGGAGCACTGACGAAGGG No data
Right 1193715136 X:84928056-84928078 TGTCAGCTGCAGGATATGGGTGG No data
1193715123_1193715136 21 Left 1193715123 X:84928012-84928034 CCCCTCCCTCTAGGAGCACTGAC No data
Right 1193715136 X:84928056-84928078 TGTCAGCTGCAGGATATGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193715136 Original CRISPR TGTCAGCTGCAGGATATGGG TGG Intergenic
No off target data available for this crispr