ID: 1193715143

View in Genome Browser
Species Human (GRCh38)
Location X:84928092-84928114
Sequence TGGGCAGGACCTCCCAAATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193715143_1193715153 30 Left 1193715143 X:84928092-84928114 CCCCATTTGGGAGGTCCTGCCCA No data
Right 1193715153 X:84928145-84928167 AAAGAAGTCTGGCCATGTTTTGG No data
1193715143_1193715146 -9 Left 1193715143 X:84928092-84928114 CCCCATTTGGGAGGTCCTGCCCA No data
Right 1193715146 X:84928106-84928128 TCCTGCCCAGTGAAGAAGAATGG No data
1193715143_1193715150 -2 Left 1193715143 X:84928092-84928114 CCCCATTTGGGAGGTCCTGCCCA No data
Right 1193715150 X:84928113-84928135 CAGTGAAGAAGAATGGAATCAGG No data
1193715143_1193715151 19 Left 1193715143 X:84928092-84928114 CCCCATTTGGGAGGTCCTGCCCA No data
Right 1193715151 X:84928134-84928156 GGCACCTGCTCAAAGAAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193715143 Original CRISPR TGGGCAGGACCTCCCAAATG GGG (reversed) Intergenic
No off target data available for this crispr