ID: 1193715150

View in Genome Browser
Species Human (GRCh38)
Location X:84928113-84928135
Sequence CAGTGAAGAAGAATGGAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193715143_1193715150 -2 Left 1193715143 X:84928092-84928114 CCCCATTTGGGAGGTCCTGCCCA No data
Right 1193715150 X:84928113-84928135 CAGTGAAGAAGAATGGAATCAGG No data
1193715144_1193715150 -3 Left 1193715144 X:84928093-84928115 CCCATTTGGGAGGTCCTGCCCAG No data
Right 1193715150 X:84928113-84928135 CAGTGAAGAAGAATGGAATCAGG No data
1193715145_1193715150 -4 Left 1193715145 X:84928094-84928116 CCATTTGGGAGGTCCTGCCCAGT No data
Right 1193715150 X:84928113-84928135 CAGTGAAGAAGAATGGAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193715150 Original CRISPR CAGTGAAGAAGAATGGAATC AGG Intergenic
No off target data available for this crispr