ID: 1193715153

View in Genome Browser
Species Human (GRCh38)
Location X:84928145-84928167
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193715145_1193715153 28 Left 1193715145 X:84928094-84928116 CCATTTGGGAGGTCCTGCCCAGT No data
Right 1193715153 X:84928145-84928167 AAAGAAGTCTGGCCATGTTTTGG No data
1193715148_1193715153 11 Left 1193715148 X:84928111-84928133 CCCAGTGAAGAAGAATGGAATCA No data
Right 1193715153 X:84928145-84928167 AAAGAAGTCTGGCCATGTTTTGG No data
1193715144_1193715153 29 Left 1193715144 X:84928093-84928115 CCCATTTGGGAGGTCCTGCCCAG No data
Right 1193715153 X:84928145-84928167 AAAGAAGTCTGGCCATGTTTTGG No data
1193715143_1193715153 30 Left 1193715143 X:84928092-84928114 CCCCATTTGGGAGGTCCTGCCCA No data
Right 1193715153 X:84928145-84928167 AAAGAAGTCTGGCCATGTTTTGG No data
1193715149_1193715153 10 Left 1193715149 X:84928112-84928134 CCAGTGAAGAAGAATGGAATCAG No data
Right 1193715153 X:84928145-84928167 AAAGAAGTCTGGCCATGTTTTGG No data
1193715147_1193715153 15 Left 1193715147 X:84928107-84928129 CCTGCCCAGTGAAGAAGAATGGA No data
Right 1193715153 X:84928145-84928167 AAAGAAGTCTGGCCATGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193715153 Original CRISPR AAAGAAGTCTGGCCATGTTT TGG Intergenic
No off target data available for this crispr