ID: 1193718329

View in Genome Browser
Species Human (GRCh38)
Location X:84958065-84958087
Sequence TCAGATCTTTAAAAGGTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193718326_1193718329 10 Left 1193718326 X:84958032-84958054 CCTTAGAGACAATAGATGACAAA 0: 91
1: 165
2: 138
3: 123
4: 347
Right 1193718329 X:84958065-84958087 TCAGATCTTTAAAAGGTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193718329 Original CRISPR TCAGATCTTTAAAAGGTGGT AGG Intergenic
No off target data available for this crispr