ID: 1193718329 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:84958065-84958087 |
| Sequence | TCAGATCTTTAAAAGGTGGT AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1193718326_1193718329 | 10 | Left | 1193718326 | X:84958032-84958054 | CCTTAGAGACAATAGATGACAAA | 0: 91 1: 165 2: 138 3: 123 4: 347 |
||
| Right | 1193718329 | X:84958065-84958087 | TCAGATCTTTAAAAGGTGGTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1193718329 | Original CRISPR | TCAGATCTTTAAAAGGTGGT AGG | Intergenic | ||
| No off target data available for this crispr | |||||