ID: 1193722798

View in Genome Browser
Species Human (GRCh38)
Location X:85006248-85006270
Sequence GTAAATCATCTGGCCAAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 126}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193722798_1193722803 22 Left 1193722798 X:85006248-85006270 CCCACTTTGGCCAGATGATTTAC 0: 1
1: 0
2: 0
3: 10
4: 126
Right 1193722803 X:85006293-85006315 TCTTGATGACCCTAAGAAATGGG 0: 1
1: 0
2: 2
3: 17
4: 148
1193722798_1193722802 21 Left 1193722798 X:85006248-85006270 CCCACTTTGGCCAGATGATTTAC 0: 1
1: 0
2: 0
3: 10
4: 126
Right 1193722802 X:85006292-85006314 CTCTTGATGACCCTAAGAAATGG 0: 1
1: 0
2: 0
3: 11
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193722798 Original CRISPR GTAAATCATCTGGCCAAAGT GGG (reversed) Intronic
905539333 1:38747547-38747569 GGAAATCATCTGACTAAATTAGG + Intergenic
907093608 1:51753468-51753490 GTAACACATCTGGTAAAAGTTGG + Intronic
913969772 1:143405811-143405833 GCACATCATGTGGCCAAAGCAGG - Intergenic
914064145 1:144231404-144231426 GCACATCATGTGGCCAAAGCAGG - Intergenic
914115005 1:144734950-144734972 GCACATCATGTGGCCAAAGCAGG + Intergenic
918866740 1:189910090-189910112 GTAGATCATATGGCAAAAGCAGG - Intergenic
919283734 1:195526180-195526202 GGAAATCTTCTGTCCTAAGTGGG + Intergenic
923249962 1:232170768-232170790 GAGAGCCATCTGGCCAAAGTGGG - Intergenic
923283345 1:232466156-232466178 GTAGCTCTTCTGACCAAAGTGGG + Intronic
1065728095 10:28685556-28685578 GAAAATCATCTTGGCAAATTTGG - Intergenic
1067781841 10:49213383-49213405 GTGAGCCATCTGCCCAAAGTTGG + Intergenic
1069213199 10:65787406-65787428 GTAAAACTTCTGGCCAAGCTTGG - Intergenic
1070426200 10:76290094-76290116 GTAACTCATTCTGCCAAAGTAGG - Intronic
1074487812 10:113905177-113905199 GTAAAGCAAATGGCCAATGTGGG - Intronic
1078773013 11:14368496-14368518 GTTAATGATATGGACAAAGTGGG + Intergenic
1082900092 11:58239076-58239098 CTAAATAATCTGACCAAATTCGG - Intergenic
1090116131 11:123976561-123976583 GTAGACCATTTGGCCAAAGCTGG + Intergenic
1091596408 12:1881839-1881861 ATAAGCCATCTGGCCAAATTTGG - Intronic
1095293531 12:40503325-40503347 GCAAATCATCTGTCAATAGTTGG + Intronic
1095925775 12:47577712-47577734 GTGAAGCATCAAGCCAAAGTGGG + Intergenic
1098660339 12:73085775-73085797 GTATATTCTCTGGCCACAGTGGG + Intergenic
1099823430 12:87744784-87744806 GTAAATCATATGCCCATCGTTGG - Intergenic
1102662910 12:114545303-114545325 GTAAATTATCTTGCCCAAGATGG + Intergenic
1103060969 12:117858374-117858396 GAAACTCATCTGGCCATACTGGG + Intronic
1106614296 13:31312256-31312278 GTAAAACATCTGGCCTCTGTTGG + Intronic
1106965827 13:35065858-35065880 GTATATTATCTGTCCAAACTGGG - Intronic
1107406932 13:40123183-40123205 GTAAATCAGCTGTGCAAAGTTGG - Intergenic
1110972403 13:81781646-81781668 GAAAACCATCTGTCCAAAATCGG - Intergenic
1114032617 14:18589437-18589459 GTAGATCATCAGGCCACAGCTGG + Intergenic
1114032908 14:18591073-18591095 GTAGATCATCAGGCCACAGCTGG + Intergenic
1114084761 14:19231101-19231123 GTAGATCATCAGGCCACAGCTGG - Intergenic
1116701249 14:48245756-48245778 GTAAATATTTTTGCCAAAGTTGG + Intergenic
1127285051 15:57525046-57525068 ATAAATCATCTGGACACAGCTGG - Intronic
1127441797 15:59016412-59016434 ATAAATAATTAGGCCAAAGTGGG - Intronic
1127848552 15:62892813-62892835 ATAAATTCTCTGGCCCAAGTTGG - Intergenic
1128248342 15:66148302-66148324 GTAAATAATCTCACCTAAGTGGG - Intronic
1130540773 15:84819453-84819475 GAAAAGCCTTTGGCCAAAGTGGG + Intronic
1130775923 15:86982800-86982822 GTAAGGCTTCTGGTCAAAGTAGG + Intronic
1133901812 16:9982702-9982724 TGAAATCAACTGGCCAAAGATGG - Intronic
1136058665 16:27709670-27709692 GTTATTCATTTGGGCAAAGTTGG + Intronic
1136499612 16:30663958-30663980 GAAAGTCATCTGGCCAGAGATGG + Intronic
1139183285 16:64771794-64771816 GTACATCATATGGCAAAAGCAGG + Intergenic
1140039034 16:71393257-71393279 GTAAAACATCTGTGCAAAGATGG + Intergenic
1140590772 16:76349591-76349613 GAAAATGATCTGGGCAAACTTGG + Intronic
1141817313 16:86421080-86421102 GCAAATCACATGGCCAGAGTAGG + Intergenic
1157049494 18:44145287-44145309 GTAAATCACATGGCCAGAGCAGG + Intergenic
1158113656 18:53970902-53970924 GTAGATTTTGTGGCCAAAGTGGG - Intergenic
1158194441 18:54868302-54868324 GTACATCATATGGCAAAAGCAGG - Intronic
1162499738 19:11045698-11045720 GTATATCATCTGACAAAAGAGGG + Intronic
929138367 2:38645994-38646016 GTAAATCATATGGCCACCTTTGG - Intergenic
929320659 2:40540045-40540067 GTAATTCATTTGGCCAAAAAAGG - Intronic
929718418 2:44338018-44338040 GTAAAAACTCAGGCCAAAGTTGG - Intronic
929905888 2:46046230-46046252 GTAAATCAGCTGCTCCAAGTTGG + Intronic
934866280 2:97815805-97815827 GTAAATCAGCAGGGCTAAGTGGG - Intronic
937720551 2:125090316-125090338 AGAAATCTTATGGCCAAAGTGGG + Intergenic
939113585 2:138035690-138035712 ATAAATCATCTTGTGAAAGTTGG + Intergenic
939908734 2:147952640-147952662 GTAAATCCCCTACCCAAAGTAGG - Intronic
942077674 2:172371619-172371641 GTAAACCAGTTGGCCAAAGGAGG + Intergenic
944287635 2:197969703-197969725 GTGAGTCATTTGGCCAAAGATGG - Intronic
945002957 2:205371120-205371142 GAAAATCATCTTGGAAAAGTGGG + Intronic
945420256 2:209627373-209627395 GTAAATTATTTCGTCAAAGTTGG + Intronic
947958753 2:234217211-234217233 GCAAAGCATGTGGCCAAATTTGG + Intergenic
948911978 2:241009413-241009435 GTGGAGCACCTGGCCAAAGTGGG + Intronic
948925998 2:241098441-241098463 GGAACTCCTCTGGTCAAAGTGGG + Intronic
1170325939 20:15154412-15154434 GTGACTCATCTGCCCAAAGTAGG - Intronic
1176094148 20:63332182-63332204 GGAGAGCATGTGGCCAAAGTAGG + Intronic
1180293211 22:10862092-10862114 GTAGATCATCAGGCCACAGCTGG + Intergenic
1180456730 22:15516494-15516516 GTAGATCATCAGGCCACAGCTGG + Intergenic
1180457023 22:15518130-15518152 GTAGATCATCAGGCCACAGCTGG + Intergenic
1180496015 22:15891514-15891536 GTAGATCATCAGGCCACAGCTGG + Intergenic
1182012026 22:27009085-27009107 GTCACTCATCTGGCCAGAGTAGG - Intergenic
1183415868 22:37681543-37681565 GGAAATCATCTACCCAAAATGGG - Intergenic
1184141864 22:42582147-42582169 GCAAATCAGCGCGCCAAAGTGGG + Intergenic
949251511 3:1990112-1990134 TTTAATCATCTGGTCACAGTGGG - Intergenic
949842858 3:8339069-8339091 GGACAGCATCTGGGCAAAGTAGG - Intergenic
949902534 3:8829542-8829564 GAAAATCAACAGGCCAAAGTTGG + Intronic
951706560 3:25549833-25549855 GCAAATTATCTGGCCAATCTCGG - Intronic
952516590 3:34110753-34110775 GTAAATTATTTGCCCAAAGTTGG - Intergenic
955458435 3:59151653-59151675 GTAGATAATCTGGACAAAGGTGG - Intergenic
957209668 3:77243511-77243533 GAAAATCATCTGGGTAAAATAGG + Intronic
957576346 3:82013687-82013709 GCACATCATATGGCAAAAGTGGG - Intergenic
962267689 3:133955293-133955315 GCACAGCCTCTGGCCAAAGTTGG - Intronic
964851386 3:161099862-161099884 GAAAAGCATCTGGGCAAAGGGGG + Intronic
972399269 4:38685310-38685332 GTTAATTATCTGCCCAGAGTTGG + Intronic
973112254 4:46411009-46411031 TTAAATTTTCTGGCCAAAGAGGG - Intronic
976966577 4:91049739-91049761 GTTAATCATCTACCCAGAGTAGG - Intronic
979382757 4:120027702-120027724 TTAGACCATCTTGCCAAAGTTGG - Intergenic
979581877 4:122370389-122370411 GTGGCTCATCTGGCCAAGGTGGG + Intergenic
989483715 5:41963509-41963531 GTAAGACTTCTGGTCAAAGTAGG - Intergenic
990288988 5:54329689-54329711 GTTAATCATCAGGCAAAAGAGGG - Intergenic
992334251 5:75749082-75749104 GCACATCATGTGGCCAAAGCAGG - Intergenic
992827764 5:80567722-80567744 GTTCATCATCTGGCCATGGTGGG + Intronic
993322602 5:86491679-86491701 GTAAAACCTATGACCAAAGTGGG + Intergenic
996389242 5:122942016-122942038 GTAAAGTATTTGGCCATAGTGGG - Intronic
1001454003 5:171846979-171847001 GCAAAGCATCTGGACATAGTAGG + Intergenic
1004804191 6:19184119-19184141 GTACATCACATGGCCAGAGTAGG - Intergenic
1011342475 6:86332268-86332290 GTAAATCATGTGGCCATCTTTGG - Intergenic
1012374876 6:98549270-98549292 TAAAATCAGCTGTCCAAAGTGGG + Intergenic
1013395437 6:109733037-109733059 GTAAATAATCTGGCAAAATTGGG + Intronic
1013948479 6:115751066-115751088 CTAAATTATCTGGAAAAAGTTGG + Intergenic
1014221613 6:118804064-118804086 GGAAAATATCTGGCCAAAATAGG - Intergenic
1017589686 6:155965529-155965551 TTAAGTCATTTGCCCAAAGTTGG - Intergenic
1019675756 7:2311594-2311616 GTAAGTAATTTGCCCAAAGTGGG - Intronic
1021022526 7:15621407-15621429 GAACTTCATCTGGCCAAAGAAGG - Intronic
1022612017 7:31885373-31885395 GAAAGGCATCTTGCCAAAGTTGG - Intronic
1023102728 7:36735599-36735621 TTAAATGATATGGCCAAACTAGG + Intergenic
1023128586 7:36979484-36979506 GTCAAATATCTGGGCAAAGTAGG - Intronic
1024104457 7:46068005-46068027 GTAACTCCTATTGCCAAAGTTGG - Intergenic
1024503192 7:50135687-50135709 GAATATCATCTGGCCCAAGAAGG - Intronic
1025781120 7:64602692-64602714 AGTAATCATCTGGCTAAAGTTGG + Intergenic
1026449801 7:70518339-70518361 CTAAATCATGTGGTCACAGTGGG + Intronic
1028697925 7:93738050-93738072 GGACTTCCTCTGGCCAAAGTGGG - Intronic
1030542192 7:110844820-110844842 GTAAATTTCCTGGCCATAGTTGG - Intronic
1031058022 7:117015297-117015319 TTAAATCCTCTGGCCTAAGAGGG - Intronic
1031950566 7:127887369-127887391 GTAGATCTTCTACCCAAAGTGGG - Intronic
1032244097 7:130193206-130193228 GTAAATAAACTGGCAAAATTAGG + Intronic
1036108396 8:5869773-5869795 GTAAAAAATCTTGCAAAAGTAGG - Intergenic
1036775417 8:11608627-11608649 GTGAAACAGCTGGCCAAAGCTGG - Intergenic
1037551376 8:19974907-19974929 GTAATTCATCTGCCCAGAGTGGG + Intergenic
1038169408 8:25115403-25115425 ATAAATCATCTGAAGAAAGTAGG + Intergenic
1046753312 8:117947229-117947251 CTAAATCGTTTGGCCATAGTTGG - Intronic
1052592212 9:30513256-30513278 GTACATCACCTGGCAAAAGCAGG - Intergenic
1052678953 9:31663502-31663524 ATAAATGAGCTGGCCAAATTTGG + Intergenic
1057296944 9:93851866-93851888 GTACATGATATGGCCATAGTTGG + Intergenic
1058243034 9:102590588-102590610 ATAAATCATTGGGTCAAAGTTGG + Intergenic
1060915891 9:127390392-127390414 GTAAATCATCTGTCCTCATTAGG + Intronic
1061669554 9:132180983-132181005 GTCAATCATCTGGCCTGAGCAGG + Intronic
1186281018 X:7993234-7993256 GGAAAACCTCTGGCCAAAGCTGG - Intergenic
1189316038 X:40057260-40057282 GTAAATCATCGGGACAACGCAGG - Exonic
1193722798 X:85006248-85006270 GTAAATCATCTGGCCAAAGTGGG - Intronic
1194487038 X:94497397-94497419 GTACATACTCTGGCCAAAATGGG + Intergenic
1194848635 X:98843841-98843863 CTAAATCATCTGGTGAAAGTGGG + Intergenic
1194994583 X:100577723-100577745 GTAAATAATCTGTCAAAAGTAGG - Intergenic
1195534122 X:105991614-105991636 GTAAAACCTATGACCAAAGTGGG + Intergenic
1196217285 X:113068455-113068477 GTATTTGCTCTGGCCAAAGTAGG - Intergenic
1197268299 X:124399461-124399483 GTAAATAATATAGCCAAAGTTGG - Intronic
1201149433 Y:11087632-11087654 GTAGATCATCAGGCCACAGCTGG - Intergenic