ID: 1193723514

View in Genome Browser
Species Human (GRCh38)
Location X:85015650-85015672
Sequence CACTTACACCCGGGAGGCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146901
Summary {0: 4, 1: 117, 2: 5642, 3: 38167, 4: 102971}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193723514_1193723524 17 Left 1193723514 X:85015650-85015672 CCTCCGCCTCCCGGGTGTAAGTG 0: 4
1: 117
2: 5642
3: 38167
4: 102971
Right 1193723524 X:85015690-85015712 TCCCGAGTACCTGGGATTATAGG 0: 66
1: 4766
2: 66627
3: 234988
4: 259033
1193723514_1193723522 9 Left 1193723514 X:85015650-85015672 CCTCCGCCTCCCGGGTGTAAGTG 0: 4
1: 117
2: 5642
3: 38167
4: 102971
Right 1193723522 X:85015682-85015704 CCTCAGCCTCCCGAGTACCTGGG 0: 1326
1: 106869
2: 295858
3: 225231
4: 120222
1193723514_1193723520 8 Left 1193723514 X:85015650-85015672 CCTCCGCCTCCCGGGTGTAAGTG 0: 4
1: 117
2: 5642
3: 38167
4: 102971
Right 1193723520 X:85015681-85015703 GCCTCAGCCTCCCGAGTACCTGG 0: 1227
1: 101067
2: 267427
3: 219186
4: 133579

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193723514 Original CRISPR CACTTACACCCGGGAGGCGG AGG (reversed) Intronic
Too many off-targets to display for this crispr