ID: 1193730078

View in Genome Browser
Species Human (GRCh38)
Location X:85092333-85092355
Sequence CTCAGGTGACAGTCAAATGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 329}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193730078 Original CRISPR CTCAGGTGACAGTCAAATGT TGG Exonic
900492226 1:2956356-2956378 CTCAGAAGACAGGAAAATGTGGG - Intergenic
901210936 1:7525737-7525759 CTCAGGTCACAGCCAAGGGTGGG + Intronic
901364420 1:8733667-8733689 CTCAGGTTGCAGTCAACTGAAGG - Intronic
902715962 1:18272862-18272884 CTCAGATGACAGAGATATGTGGG + Intronic
902860922 1:19245013-19245035 CTCAGGAGACAGCAATATGTTGG - Exonic
903316330 1:22510273-22510295 TGCAGGTGACAGCCACATGTTGG + Intronic
905320543 1:37113696-37113718 CTCACGTCACAGTCTGATGTGGG - Intergenic
906309923 1:44746513-44746535 GTCTGGTGAGAGTCAAATGGGGG - Intronic
906369695 1:45242183-45242205 AAAAGGTGACAGTAAAATGTGGG - Intronic
906769939 1:48474906-48474928 CTCAGAAGACAGGAAAATGTGGG + Intergenic
906865593 1:49415527-49415549 CTGAAGTGACATTAAAATGTAGG + Intronic
908020089 1:59890167-59890189 CTCAGAAGACAGGAAAATGTGGG - Intergenic
909065668 1:70932295-70932317 CTCAGAAGACAGGAAAATGTGGG - Intronic
909257120 1:73438426-73438448 CTCAGAAGACAGGAAAATGTAGG + Intergenic
910748870 1:90605620-90605642 CTGAGGTCACAGTGAAATTTTGG + Intergenic
910970232 1:92848771-92848793 TGCAGGAGACACTCAAATGTTGG + Intronic
912099107 1:106184201-106184223 CTCAGAAGACAGGAAAATGTGGG + Intergenic
912238208 1:107875814-107875836 CCCAGGTGAGAGACAACTGTGGG + Intronic
912393532 1:109321643-109321665 CGCAGGTGACAGTAGAATATAGG - Intronic
912943403 1:114065204-114065226 CTCAGCTTACAGTCTATTGTGGG - Intergenic
913564913 1:120063449-120063471 CTCAGGTAACATTCTAATGGAGG + Intronic
913633217 1:120730114-120730136 CTCAGGTAACATTCTAATGGAGG - Intergenic
913978836 1:143489301-143489323 CTCAGAAGACAGGAAAATGTGGG - Intergenic
914073242 1:144314950-144314972 CTCAGAAGACAGGAAAATGTGGG - Intergenic
914105912 1:144651410-144651432 CTCAGAAGACAGGAAAATGTGGG + Intergenic
914285499 1:146222799-146222821 CTCAGGTAACATTCTAATGGAGG + Intronic
914546530 1:148673554-148673576 CTCAGGTAACATTCTAATGGAGG + Intronic
914620035 1:149397116-149397138 CTCAGGTAACATTCTAATGGAGG - Intergenic
915923300 1:159995191-159995213 CTCAGAAGACAGGAAAATGTGGG - Intergenic
915983022 1:160434291-160434313 CTCAGAAGACAGGAAAATGTGGG - Intergenic
917152275 1:171957853-171957875 CTCAGAAGACAGGAAAATGTGGG - Intronic
918786964 1:188775453-188775475 CTCAGAAGACAGGAAAATGTGGG + Intergenic
918963271 1:191306875-191306897 CTCAGGAGTCACTCCAATGTGGG + Intergenic
919028015 1:192202292-192202314 CTCAGAAGACAGGAAAATGTGGG - Intergenic
919593496 1:199533025-199533047 CTCAGAAGACAGGAAAATGTGGG + Intergenic
921763094 1:218939882-218939904 CTCAGAAGACAGGAAAATGTGGG + Intergenic
922029054 1:221780560-221780582 ATGAGGTCACAATCAAATGTCGG - Intergenic
922149537 1:222986387-222986409 CTCAAGTGACATTAAAATGGGGG - Intronic
922320281 1:224480830-224480852 CTCAGAAGACAGGAAAATGTGGG - Intronic
922530359 1:226340587-226340609 CTCAGAAGACAGGAAAATGTAGG + Intergenic
923919473 1:238547136-238547158 CTCAGATGACAGGAAAATGTGGG - Intergenic
1063049555 10:2432227-2432249 CTCATGTGACAGTGACAAGTTGG - Intergenic
1064921313 10:20522054-20522076 CTCAGGTGCCCATCAATTGTGGG - Intergenic
1066697967 10:38095126-38095148 CTCAAGTGACAGGAAGATGTAGG + Intronic
1070807803 10:79280745-79280767 CAAAGGTGAGACTCAAATGTGGG - Intronic
1071776781 10:88798070-88798092 CTCAGAAGACAGGAAAATGTGGG - Intergenic
1072205041 10:93196086-93196108 ATGAGGCTACAGTCAAATGTTGG - Intergenic
1075736053 10:124665232-124665254 CTCAGGTGATAGACAAGTTTGGG - Intronic
1076059400 10:127401741-127401763 GTCAGGTGACCGTCAGATGATGG - Intronic
1079134977 11:17771331-17771353 CTCAGGTAACAGTTCAATGTGGG + Intronic
1079341156 11:19612757-19612779 CTCAGAAGACAGGAAAATGTGGG - Intronic
1080477545 11:32609531-32609553 CTCAGAAGACAGGAAAATGTGGG - Intronic
1080854454 11:36100201-36100223 CTCAGGTGACTGTAGAATGGTGG - Intronic
1081175316 11:39921107-39921129 CTCAGAAGACAGAAAAATGTGGG + Intergenic
1081238813 11:40678951-40678973 CTCAGAAGACAGGAAAATGTGGG + Intronic
1081437380 11:43041714-43041736 CTCAGAAGACAGGAAAATGTGGG - Intergenic
1082734379 11:56839623-56839645 CTCAGAAGACAGGGAAATGTGGG - Intergenic
1083065334 11:59917721-59917743 CTCAGAAGACAGGAAAATGTGGG - Intergenic
1084803022 11:71558117-71558139 CTCAGTTGACAGAAAAATGCAGG - Intronic
1086081713 11:82909719-82909741 CTAAGGTGACAACCAAATCTAGG + Intronic
1087550351 11:99640139-99640161 CTCAGAAGACAGGAAAATGTGGG - Intronic
1087932723 11:103997216-103997238 CTGAGGTCACAGGCAAATGATGG + Intronic
1088762888 11:112949079-112949101 CTCAGAAGACAGAAAAATGTGGG - Intergenic
1088877096 11:113945098-113945120 CTCAGCTGAAAGTCTAATTTTGG + Intronic
1089152866 11:116377638-116377660 CTCATGTCACAGTCCAATGCAGG - Intergenic
1090506412 11:127320284-127320306 CTCAGAAGACAGTAAGATGTGGG - Intergenic
1091168155 11:133498629-133498651 CTCAGCTGCAAGACAAATGTAGG + Intronic
1093141945 12:15518890-15518912 CTCAGAAGACAGTAAAATGTGGG - Intronic
1093206965 12:16263115-16263137 CTCAGAAGACAGGAAAATGTGGG + Intronic
1094489349 12:30949188-30949210 CTCAGAAGACAGGAAAATGTGGG - Intronic
1095919297 12:47513496-47513518 CTCAGGAGACAGAAAGATGTGGG + Intergenic
1096246770 12:49994396-49994418 CTGAGGTAAGAGTCAACTGTAGG - Exonic
1097329706 12:58319414-58319436 CTCAGAAGACAGGAAAATGTGGG - Intergenic
1097654801 12:62345516-62345538 CTCAGAAGACAGGAAAATGTGGG - Intronic
1098149792 12:67535012-67535034 CTCAAGAGCGAGTCAAATGTTGG + Intergenic
1098578554 12:72071780-72071802 CTCAGAAGACAGGAAAATGTGGG - Intronic
1099437490 12:82661134-82661156 GTCAGGTGACCGTCAAGTGGTGG - Intergenic
1099858849 12:88204325-88204347 CTCAGAAGACAGGAAAATGTGGG + Intergenic
1101190346 12:102326063-102326085 CTCAGAAGACAGGAAAATGTGGG + Intergenic
1101316599 12:103634698-103634720 CTCATGTAACAGTCCAATGTGGG + Intronic
1103223065 12:119262481-119262503 CTCAGGTGAAAGTCATCTGACGG + Intergenic
1103815002 12:123647723-123647745 CTGTGGTGATAGACAAATGTTGG + Intronic
1105754766 13:23454108-23454130 CTCAGGTCAAAGCCAAAGGTAGG + Intergenic
1106631661 13:31480457-31480479 CTCAGAAGACAGAAAAATGTGGG - Intergenic
1107039536 13:35934211-35934233 CTCAGAAGACAGGAAAATGTGGG - Intronic
1108790588 13:53965586-53965608 CTCAGAAGACAGGAAAATGTGGG + Intergenic
1109667680 13:65559914-65559936 CTCAGGAGACAGGAAAATGTGGG - Intergenic
1110559854 13:76899126-76899148 CTCAGAAGACAGGAAAATGTGGG - Intergenic
1111421528 13:88018168-88018190 CTCAGAAGACAGGAAAATGTGGG + Intergenic
1112373511 13:98816716-98816738 GTCAGGTGAAAGTGAAAGGTGGG + Intronic
1112815437 13:103267688-103267710 CTCAGAAGACAGGAAAATGTGGG + Intergenic
1112888562 13:104204576-104204598 GTCAGGTGACTGTCAAAAGATGG - Intergenic
1114940419 14:27603516-27603538 CTCAGGAGAAAGACAAAGGTAGG + Intergenic
1115515714 14:34182905-34182927 CTCCAGTGGCAGTCAGATGTTGG - Intronic
1116564985 14:46433206-46433228 CTCAGAAGACAGGAAAATGTGGG - Intergenic
1117198611 14:53365006-53365028 CTCAGAAGACAGAAAAATGTGGG - Intergenic
1117445348 14:55798938-55798960 CTCACATAACAGTCAAATGCAGG + Intergenic
1117799499 14:59428413-59428435 CTGAGGTGACAGTCTGCTGTGGG - Intergenic
1118037485 14:61883591-61883613 CTCAGATGACAGAAAAATGTAGG - Intergenic
1118992228 14:70808214-70808236 CTCAGTTGCCTGTAAAATGTCGG - Intronic
1119040300 14:71268690-71268712 CTCAGAAGACAGGAAAATGTGGG + Intergenic
1119444558 14:74652558-74652580 CTGAGTTGCCAGTCAAATGATGG + Intergenic
1119776084 14:77249615-77249637 CTCAGCTGAGACTCTAATGTAGG - Intronic
1120405139 14:84084768-84084790 CTCAGAAGACAGAAAAATGTGGG - Intergenic
1120494177 14:85213395-85213417 CTAATGTTACAGTCCAATGTAGG - Intergenic
1120688136 14:87562874-87562896 CTCAGAAGACAGGAAAATGTGGG + Intergenic
1121644671 14:95509592-95509614 CCCAGGTGAAGGTCAAATGCAGG + Intergenic
1123151467 14:106185652-106185674 CCCCTGAGACAGTCAAATGTGGG - Intergenic
1202878185 14_KI270722v1_random:28928-28950 CTCAGGTCTAAGTCAAATGCAGG + Intergenic
1123399864 15:19973535-19973557 CCCATGAGACAGTCAAATGTGGG - Intergenic
1125137585 15:36362120-36362142 CTCATGAGATAGTTAAATGTAGG - Intergenic
1125160350 15:36636202-36636224 GTCAGGTAACAGTCAAATTGTGG - Intronic
1125304311 15:38292294-38292316 CTCAGAAGACAGGAAAATGTGGG - Intronic
1126255997 15:46626619-46626641 CTCAGAAGACAGGAAAATGTGGG + Intergenic
1126274642 15:46862544-46862566 CTCAGGAGACAGGAAGATGTGGG + Intergenic
1126873341 15:53012129-53012151 CTCAGAAGACAGGAAAATGTGGG - Intergenic
1128119872 15:65137818-65137840 CTCAGAAGACAGGAAAATGTGGG - Intergenic
1131279862 15:91012266-91012288 TTCAGGTGACATTCAAAGGAAGG + Intronic
1132122705 15:99191829-99191851 CTCAGAAGACAGGAAAATGTGGG + Intronic
1135420439 16:22302221-22302243 CTCAGGTGACAGGTACAGGTAGG - Intronic
1135815642 16:25630233-25630255 CTGAGCTGAGAGTCAAATGCTGG + Intergenic
1136642274 16:31576998-31577020 CTCAGAAGACAGGAAAATGTGGG + Intergenic
1137991107 16:53156443-53156465 ATCAGATGGCAGTCCAATGTGGG + Exonic
1146821726 17:35988490-35988512 CTCATGTTACAGTCCAGTGTGGG + Intronic
1148741125 17:49893409-49893431 CCCACGTGAGACTCAAATGTGGG - Intergenic
1149072112 17:52555723-52555745 CTCAGAAGACAGGCAGATGTGGG + Intergenic
1149143074 17:53457511-53457533 CTCAGGAGACAGGAAAATGTGGG + Intergenic
1153258038 18:3192596-3192618 CTCAGGTGACACTCAAAGTGAGG - Intronic
1153348447 18:4053017-4053039 CTCAGAAGACAGGAAAATGTGGG - Intronic
1153892551 18:9531721-9531743 TACAGGTGAAAGTCAATTGTTGG + Intronic
1155515908 18:26623867-26623889 CTCAGGAGACAGGAAGATGTGGG + Intronic
1155842972 18:30668870-30668892 CTCAGGAGACAGGAAGATGTGGG - Intergenic
1157743955 18:50118449-50118471 TTCAGGAGACTGTCAAATTTGGG - Intronic
1158300727 18:56049158-56049180 CTAAGATGACACTAAAATGTTGG + Intergenic
1158335709 18:56413519-56413541 CTCAGAAGACAGGAAAATGTGGG + Intergenic
1158791716 18:60787983-60788005 CTCAGGTGACTTTCAACTGATGG + Intergenic
1159083334 18:63760070-63760092 CTCAGAAGACAGGAAAATGTGGG + Intronic
1161621470 19:5299510-5299532 TTCAGGTGACAGTAAAATAATGG - Intronic
1163595250 19:18217543-18217565 CTCAGTTGACAGGCAATTATTGG - Intronic
1164213828 19:23125346-23125368 CTCAGAAGACAGGAAAATGTGGG + Intronic
1166328923 19:42067662-42067684 CACAGGTGGCAGCCAAAGGTGGG + Intronic
1167063405 19:47165992-47166014 CACAGGTGACAGCCAGAAGTGGG - Intronic
926174558 2:10578553-10578575 CACAGATGACAGTGAAATGCAGG - Intronic
926431138 2:12786719-12786741 CTCAGAAGACAGAAAAATGTGGG - Intergenic
926734708 2:16064175-16064197 CTCAGAAGACAGGAAAATGTGGG - Intergenic
926840071 2:17070447-17070469 CTCAGATGACAGGAAGATGTGGG + Intergenic
926952032 2:18253437-18253459 CTCAGAAGACAGGAAAATGTGGG + Intronic
926963809 2:18387796-18387818 CTAAGGTGACTGTGCAATGTGGG - Intergenic
927360102 2:22223150-22223172 CTCAGAAGACAGGAAAATGTAGG + Intergenic
927735072 2:25513104-25513126 CTCAGGCACCAGTCAAAAGTGGG + Intronic
927813491 2:26193869-26193891 GTCAGGTGACACTCAGAAGTGGG - Intronic
928048782 2:27967634-27967656 CTCAGAAGACAGGAAAATGTGGG + Intronic
928609831 2:32982062-32982084 CTCAGAAGACAGGAAAATGTGGG + Intronic
928680229 2:33693795-33693817 CTCAGAAGACAGGAAAATGTGGG - Intergenic
928927467 2:36594211-36594233 CTCAGAAGACAGGAAAATGTGGG - Intronic
929020472 2:37547744-37547766 CTCAGAAGACAGGAAAATGTGGG - Intergenic
933085018 2:78045328-78045350 CTCAGAAGACAGGAAAATGTCGG + Intergenic
934183560 2:89650382-89650404 CTCAGAAGACAGGAAAATGTGGG - Intergenic
934293843 2:91724554-91724576 CTCAGAAGACAGGAAAATGTGGG - Intergenic
935978660 2:108605086-108605108 CTCAGGTCACAGTCCAATACAGG - Intronic
936862456 2:117033608-117033630 CTCAGAAGACAGGAAAATGTGGG - Intergenic
937197284 2:120170361-120170383 CACAGGCTACAGTCAAATATTGG + Intronic
937553785 2:123129300-123129322 CTAATGTGACAGTAAAATGCAGG - Intergenic
938165280 2:129020594-129020616 CTCAGAAGACAGGAAAATGTGGG + Intergenic
938698062 2:133852540-133852562 CTCAGAAGACAGGAAAATGTGGG + Intergenic
938988431 2:136602924-136602946 CTCAGAAGACAGGCAGATGTAGG - Intergenic
939037307 2:137148522-137148544 CTCAGAAGACAGGAAAATGTAGG + Intronic
939105061 2:137939430-137939452 CCCATGTTAGAGTCAAATGTGGG + Intergenic
939225215 2:139355461-139355483 CTCAAGTGAAAATAAAATGTAGG - Intergenic
939315336 2:140541954-140541976 TTCAGGTGATAGTTAAATCTGGG - Exonic
939594039 2:144102986-144103008 CTCAGGTGATAGTGAAAGTTTGG - Intronic
939752524 2:146064805-146064827 CTCAGAAGACAGGAAAATGTGGG - Intergenic
940135829 2:150435158-150435180 CTCAGAAGACAGGAAAATGTGGG + Intergenic
940501864 2:154503756-154503778 CTCAGAAGACAGGAAAATGTGGG + Intergenic
941452083 2:165672083-165672105 CTCAGAAGACAGGAAAATGTGGG - Intronic
941536081 2:166723599-166723621 CTCAGAAGACAGGAAAATGTGGG - Intergenic
942506828 2:176650857-176650879 TCCAGGTGAAAGTCAATTGTGGG + Intergenic
942724849 2:178995025-178995047 CTCAGAAGACAGGAAAATGTGGG - Intronic
943006640 2:182393947-182393969 CTCAGAAGACAGTAAGATGTGGG - Intronic
944371286 2:198986317-198986339 CTCAGAAGACAGGAAAATGTGGG - Intergenic
945333368 2:208563846-208563868 CTCAGGAAACAGTAAGATGTAGG - Intronic
945709388 2:213277413-213277435 CTCAGAAGACAGGAAAATGTCGG + Intergenic
946903890 2:224397551-224397573 CTCAGAAGACAGGAAAATGTGGG + Intronic
948685722 2:239668470-239668492 CTCAAGAGACATTCAAATGCTGG - Intergenic
1168960637 20:1866999-1867021 CTCAGGTCACAGTCCAGTGTAGG - Intergenic
1169580805 20:7021707-7021729 CTCAGAAGACAGGAAAATGTGGG + Intergenic
1169691111 20:8333250-8333272 CTCATGTGAAAATCCAATGTGGG - Intronic
1170586148 20:17735557-17735579 CTCACGTGACAATCAAAGGAGGG - Intronic
1172035144 20:32005334-32005356 TTCAGGTAACAGTCAAGGGTGGG - Intergenic
1173491722 20:43488041-43488063 CTCAGAAGACAGGAAAATGTGGG - Intergenic
1174244416 20:49165793-49165815 CTCAGTTGACAGACGATTGTAGG - Intronic
1176883676 21:14229013-14229035 CTCAGGAGACAGGAAGATGTGGG + Intergenic
1177288094 21:19077168-19077190 CTCAGAAGACAGGAAAATGTGGG + Intergenic
1177656104 21:24019602-24019624 CTCAGAAGACAGGCAGATGTGGG + Intergenic
1177847055 21:26301879-26301901 CTCAGAAGACAGCAAAATGTGGG - Intergenic
1182019505 22:27069129-27069151 CTCATGGCACAGTCCAATGTGGG - Intergenic
1182815775 22:33162039-33162061 CTCAGAAGACAGAAAAATGTGGG - Intergenic
1183714221 22:39524311-39524333 CTCAGGTGACAGTCTATGCTGGG - Intergenic
1184112138 22:42401655-42401677 CACAGTTGAAAGGCAAATGTTGG - Intronic
949768687 3:7554615-7554637 CTCATGTCACAGTCTAGTGTGGG + Intronic
950806198 3:15604935-15604957 CTCAGAAGACAGGAAAATGTGGG - Intronic
951632081 3:24733283-24733305 AACAGGTGACAATCTAATGTAGG + Intergenic
952261485 3:31744581-31744603 GGCAAGTGACAGTCAAAGGTGGG + Intronic
955472252 3:59297911-59297933 CTCAGAAGACAGGAAAATGTGGG + Intergenic
955698736 3:61662455-61662477 ATGAGGTTACAGTCAAGTGTTGG - Intronic
956526741 3:70172292-70172314 TTAAGGTGACAGTCTCATGTTGG + Intergenic
958583276 3:96053254-96053276 CTCAGAAGACAGGAAAATGTGGG - Intergenic
958955245 3:100459494-100459516 CTCAGAAGACAGGAAAATGTGGG - Intergenic
959172621 3:102860836-102860858 CTCAGAAGACAGGAAAATGTGGG - Intergenic
960224829 3:115157170-115157192 CTCAGAAGACAGGAAAATGTGGG + Intergenic
961485115 3:127210756-127210778 CTCAGGGGACAGTCAGACTTGGG - Intergenic
963368525 3:144368343-144368365 CTCAGAAGACAGGAAAATGTGGG - Intergenic
964175390 3:153821599-153821621 GTCAGGTGACAATCAAGTGATGG + Intergenic
965045396 3:163571667-163571689 CTCAGAAGACAGGAAAATGTGGG + Intergenic
965864968 3:173195137-173195159 CTCAGAAGACAGGAAAATGTGGG + Intergenic
967801178 3:193661741-193661763 GTGTGGTGACAGTCAAATGATGG + Intronic
970722452 4:19003652-19003674 CTCAGGCCACAGACAAATATGGG - Intergenic
971111492 4:23591129-23591151 CTCAGAAGACAGGAAAATGTAGG + Intergenic
971744762 4:30565712-30565734 CTCAGAAGACAGGAAAATGTGGG + Intergenic
971939704 4:33199259-33199281 CTCAGAAGACAGGAAAATGTGGG + Intergenic
972012754 4:34205339-34205361 CTCAGAAGACAGGAAAATGTGGG + Intergenic
972063346 4:34909398-34909420 CTCAGAAGACAGAAAAATGTGGG + Intergenic
972749268 4:41972504-41972526 CTCAGAAGACAGGAAAATGTGGG + Intergenic
974797011 4:66766197-66766219 CTCAGAAGACAGGAAAATGTGGG + Intergenic
975536280 4:75454522-75454544 CTCAAGTGACCATCAAATGGTGG + Intergenic
977021355 4:91764604-91764626 CTCAGAAGACAGGAAAATGTAGG + Intergenic
977943045 4:102878732-102878754 CTCAGAAGACAGTAAGATGTGGG - Intronic
978083497 4:104622119-104622141 CTCAGAAGACAGAAAAATGTGGG - Intergenic
978213248 4:106163295-106163317 CTCAGAAGACAGGCAGATGTGGG - Intronic
978226148 4:106337787-106337809 CTCAGGAGATAGGAAAATGTGGG + Intronic
979177047 4:117678545-117678567 CTCAGAAGACAGGAAAATGTGGG + Intergenic
979718938 4:123875658-123875680 CTCAAGTGGAAGTAAAATGTTGG - Intergenic
980181686 4:129408810-129408832 CTCATGGGAAAGTCACATGTGGG - Intergenic
980310803 4:131126823-131126845 CTCAGAAGACAGGAAAATGTGGG - Intergenic
980720497 4:136688266-136688288 CTCAGAAGACAGAAAAATGTGGG - Intergenic
983105547 4:163681916-163681938 CTCAGAAGACAGGAAAATGTGGG + Intronic
986455387 5:7913067-7913089 CTCAGAAGACAGGAAAATGTGGG - Intergenic
987435155 5:17884997-17885019 CTCAGAAGACAGGAAAATGTGGG + Intergenic
988080812 5:26412040-26412062 CTGAGATGACACTTAAATGTAGG + Intergenic
988200023 5:28055446-28055468 CTCAGAAGACAGGAAAATGTCGG - Intergenic
988473970 5:31566382-31566404 CTCAGAAGACAGGAAAATGTGGG - Intergenic
989085393 5:37671200-37671222 ATGAGAGGACAGTCAAATGTTGG + Intronic
989985035 5:50687422-50687444 CTCAGAAGACAGAAAAATGTGGG - Intronic
990193394 5:53287069-53287091 CTCAGAAGACAGGAAAATGTGGG - Intergenic
990252473 5:53930332-53930354 CTCAGGTGACCAAGAAATGTTGG - Intronic
990525978 5:56628288-56628310 CTCAGAAGACAGGAAAATGTGGG + Intergenic
990941554 5:61207331-61207353 CTCAGAAGACAGGAAAATGTGGG - Intergenic
992004446 5:72463592-72463614 CTCAGGGGCCAGGCAATTGTAGG + Intronic
992602504 5:78416993-78417015 ATCAGGTAAAAGTCAAATGTAGG - Intronic
994433933 5:99704770-99704792 CTCAGTTGGCAGTAAATTGTGGG - Intergenic
994908397 5:105869266-105869288 CTCAGGTGGTAGTCACAGGTTGG - Intergenic
996214411 5:120849561-120849583 CTCAGAAGACAGGAAAATGTGGG - Intergenic
998958063 5:147456962-147456984 TTCAGGTGATAGCCAAATGATGG - Intronic
1001943741 5:175760547-175760569 CTCAGAAGACAGGAAAATGTGGG + Intergenic
1002858967 6:1062978-1063000 CTCAGGTCACAGTTGAATGTGGG + Intergenic
1003192373 6:3885934-3885956 CTCAGGTGACATTCAAACAGAGG - Intergenic
1004266049 6:14149359-14149381 TTTAGGTTAAAGTCAAATGTTGG + Intergenic
1004778713 6:18880531-18880553 CTCATGTGACTTTCAAATGTTGG + Intergenic
1005953552 6:30647989-30648011 CTCAGGAGACAGTTAAAGGCTGG - Intronic
1005982895 6:30851054-30851076 CTCAGAAGACAGGAAAATGTGGG + Intergenic
1007672488 6:43567470-43567492 CTCATGTAACAGTCACAGGTAGG + Intronic
1008746682 6:54678943-54678965 GTAAGGTGACACTCAAATGATGG + Intergenic
1009051504 6:58282239-58282261 CTCAGAAGACAGACAGATGTGGG + Intergenic
1009528641 6:64780913-64780935 CTCAAATAACAGTCTAATGTGGG + Intronic
1010550935 6:77221940-77221962 CTCAGAAGACAGACAGATGTGGG + Intergenic
1011431887 6:87296143-87296165 GTCAGGTGACAGATAAATCTAGG + Intronic
1011462051 6:87614870-87614892 CTCAGAAGACAGGAAAATGTGGG - Intronic
1011573548 6:88767832-88767854 CTCAGTTGCCAGTCAAATGTGGG - Intronic
1012179958 6:96140308-96140330 CTCAGAAGACAGTAAGATGTGGG - Intronic
1014183341 6:118408331-118408353 CCCAGGAGACAAGCAAATGTGGG + Intergenic
1015995675 6:138993482-138993504 CTCAGGAGACAGGAAGATGTGGG + Intergenic
1016790324 6:148060806-148060828 CTCAGAAGACAGGAAAATGTAGG - Intergenic
1017995689 6:159529926-159529948 GTCAGGTCACACACAAATGTAGG - Intergenic
1018507193 6:164484109-164484131 CTCAGGAGATAGGAAAATGTGGG - Intergenic
1018673017 6:166195043-166195065 CTCTGGTGACAGTCACAAGGAGG + Intergenic
1019024695 6:168949293-168949315 CTCAGCTGACAGAAAAATGCAGG - Intergenic
1019466113 7:1190149-1190171 GGCAGGAGTCAGTCAAATGTAGG + Intergenic
1019466150 7:1190390-1190412 GGCAGGAGTCAGTCAAATGTAGG + Intergenic
1019466169 7:1190504-1190526 GGCAGGAGTCAGTCAAATGTAGG + Intergenic
1021076479 7:16310428-16310450 CTTGGGTGACAGTTAAATATGGG - Intronic
1021882734 7:25110141-25110163 CTCAGAAGACAGGAAAATGTGGG + Intergenic
1021914497 7:25418050-25418072 CTCAGGTCCCACTCAGATGTGGG - Intergenic
1022169197 7:27807162-27807184 CTCCAGTTACTGTCAAATGTTGG - Intronic
1022334359 7:29408309-29408331 CTCAGGTGATTGTCAAGTGCAGG + Intronic
1023009160 7:35909948-35909970 CTGAGGCTACAGTCAACTGTGGG + Intergenic
1027300491 7:76828677-76828699 CTCAGAAGACAGGAAAATGTGGG - Intergenic
1027471752 7:78582643-78582665 CTCAAGCAACAGTCAAATGCAGG - Intronic
1027970458 7:85074163-85074185 CCCAGGAGACAGGCAAGTGTTGG + Intronic
1030851154 7:114487871-114487893 CTCAGAAGACAGGAAAATGTGGG - Intronic
1033574678 7:142669252-142669274 CTCAGGTCCTAGTCAAATGAAGG - Intergenic
1033774041 7:144587150-144587172 CTCAGGTGACAGGCCCGTGTCGG + Intronic
1036022964 8:4868740-4868762 CACTGGTGACTGTCAAATATTGG + Intronic
1036515531 8:9440125-9440147 ATTAGGTGACAGTCACAGGTAGG + Intergenic
1037081853 8:14797178-14797200 CTCAGAAGACAGGAAAATGTGGG + Intronic
1037365305 8:18115899-18115921 CTCAGGTGACTGTCAAACCATGG - Intergenic
1038723094 8:30055607-30055629 CTCAGAGTAGAGTCAAATGTTGG + Intergenic
1038880554 8:31606194-31606216 CTCAGAAGACAGGAAAATGTGGG - Intergenic
1038903291 8:31868507-31868529 ATCAGGTCACTGACAAATGTAGG - Intronic
1039005081 8:33027121-33027143 GTCAGGTGACCATCAAATGATGG - Intergenic
1039082434 8:33746076-33746098 CTCAGAAGACAGTAAGATGTGGG - Intergenic
1040416552 8:47200980-47201002 CTCAGGTGCCAGACACAGGTAGG + Intergenic
1040813317 8:51481116-51481138 CTCAGAAGACAGGCAGATGTGGG + Intronic
1042080698 8:65047713-65047735 CTCAGAAGACAGGAAAATGTGGG - Intergenic
1042781637 8:72497178-72497200 CTCAGGTGAATGTCAAACTTGGG - Intergenic
1042989339 8:74621192-74621214 CTCAGATGACAGGAAGATGTGGG - Intronic
1043297568 8:78684064-78684086 CTCAGAAGACAGAAAAATGTGGG - Intronic
1043398422 8:79860299-79860321 CTCAAGTGACAGTCATACTTTGG + Intergenic
1044073058 8:87785929-87785951 CTCAGAAGACAGGAAAATGTGGG - Intergenic
1044737152 8:95290600-95290622 CTCACGAAACAGTCAAATATGGG - Intergenic
1044811116 8:96063155-96063177 CTCATGTCACAGTCCAATATGGG - Intergenic
1045617988 8:103940008-103940030 CTCAGAAGACAGGAAAATGTAGG - Intronic
1045894899 8:107203078-107203100 CTCAGAAGACAGAAAAATGTGGG - Intergenic
1046786566 8:118272872-118272894 CTCAGGAGACAGGCAGATGTGGG - Intronic
1047490519 8:125370555-125370577 CTCAGAAGACAGGAAAATGTAGG - Intergenic
1048189350 8:132273984-132274006 CTCAGAAGACAGGAAAATGTGGG - Intronic
1048479134 8:134771629-134771651 CTCAGAAGACAGGAAAATGTGGG - Intergenic
1050811155 9:9749388-9749410 CTCAGGAGACAGACAAATGGAGG - Intronic
1052176077 9:25464340-25464362 CTCAGATGACAGGAAGATGTGGG - Intergenic
1053274483 9:36772874-36772896 CTCAGCTAACAGTCAGGTGTGGG - Intergenic
1055174518 9:73300459-73300481 CTCAGAAGACAGAAAAATGTGGG - Intergenic
1055264027 9:74475176-74475198 CTCAGAAGACAGGAAAATGTGGG + Intergenic
1056064281 9:82917027-82917049 CTCAGAAGACAGGAAAATGTGGG - Intergenic
1056439167 9:86603239-86603261 GTCAGGTGACAATCAGATGATGG - Intergenic
1058223542 9:102332291-102332313 CTTAGGTGCCAGTCAATGGTGGG - Intergenic
1058396925 9:104564923-104564945 CACAGGTCACAGTCAAATATTGG + Intergenic
1058635241 9:107032096-107032118 CTCAGAAGACAGGAAAATGTGGG + Intergenic
1059334066 9:113557646-113557668 CAGAGCTGACAGTCTAATGTGGG + Intronic
1059730374 9:117051187-117051209 TTTAGGTGACACTCAAATGCAGG - Intronic
1060422088 9:123476500-123476522 ATCAGGTGACCAACAAATGTTGG - Intronic
1061418716 9:130461891-130461913 GGAAGGTGACAGTGAAATGTTGG + Intronic
1187233213 X:17442233-17442255 CTCATGTTACAGTCCAGTGTGGG + Intronic
1187667493 X:21629272-21629294 CTCAGAAGACAGGAAAATGTGGG - Intronic
1188660342 X:32751217-32751239 CTCAGAAGACAGGAAAATGTGGG + Intronic
1188804593 X:34571201-34571223 CTCAGAAGACAGGAAAATGTGGG - Intergenic
1191778409 X:64843258-64843280 GTCAGGTGTCACTCAAATGGAGG - Intergenic
1193519691 X:82513112-82513134 CTCAGAAGACAGAAAAATGTGGG - Intergenic
1193730078 X:85092333-85092355 CTCAGGTGACAGTCAAATGTTGG + Exonic
1194566328 X:95493675-95493697 CTCAGAAGACAGGGAAATGTGGG + Intergenic
1194591172 X:95801673-95801695 GTCATGTGACAGAAAAATGTGGG + Intergenic
1197451961 X:126629965-126629987 CTCAGATGACAGAAAGATGTGGG - Intergenic
1198568909 X:137934516-137934538 CTCAGAAGACAGGAAAATGTGGG + Intergenic
1198888282 X:141362938-141362960 CTCAGAAGACAGGAAAATGTGGG - Intergenic
1199240871 X:145546000-145546022 CTCAGAAGACAGGAAAATGTGGG - Intergenic
1199619329 X:149685426-149685448 CTCAGGAGACAGGAAGATGTAGG + Intergenic
1200693046 Y:6327938-6327960 ATTAGGTGACAGGAAAATGTTGG - Intergenic
1201042226 Y:9846788-9846810 ATTAGGTGACAGGAAAATGTTGG + Intergenic