ID: 1193731409

View in Genome Browser
Species Human (GRCh38)
Location X:85107942-85107964
Sequence CACTCAGGACTAGTTCGCTC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 37
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 34}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193731407_1193731409 -1 Left 1193731407 X:85107920-85107942 CCTGGTTGGCTTATGCTTGCTTC 0: 1
1: 0
2: 1
3: 10
4: 103
Right 1193731409 X:85107942-85107964 CACTCAGGACTAGTTCGCTCAGG 0: 1
1: 0
2: 0
3: 2
4: 34
1193731402_1193731409 29 Left 1193731402 X:85107890-85107912 CCTGATTGGCTTGGGGCTCGTTG 0: 1
1: 0
2: 1
3: 2
4: 62
Right 1193731409 X:85107942-85107964 CACTCAGGACTAGTTCGCTCAGG 0: 1
1: 0
2: 0
3: 2
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193731409 Original CRISPR CACTCAGGACTAGTTCGCTC AGG Exonic
900407104 1:2497624-2497646 CACTCAGGGCTCGGACGCTCAGG + Intronic
902367953 1:15989654-15989676 CACACAGGACAAGTGCTCTCAGG + Intergenic
907838434 1:58133338-58133360 CACTCAGGAATCGTACTCTCTGG + Intronic
1075895051 10:125987886-125987908 GACTCAGTACTACTTCCCTCTGG + Intronic
1084056575 11:66637958-66637980 CGCTGAGGACAAGTTCCCTCTGG - Intronic
1086431704 11:86742622-86742644 TACTCAGGACTAGTTCTCTATGG + Intergenic
1095794380 12:46201730-46201752 CTCTCAGGTCAAGTTCACTCTGG + Intronic
1102617568 12:114167959-114167981 CATTTAGGACTAGTTCCCTTAGG + Intergenic
1107989822 13:45810008-45810030 GACTCAGGACTAGCTCGACCAGG - Intronic
1109370279 13:61413761-61413783 CACTCAGCACCGGTGCGCTCTGG + Exonic
1124555250 15:30719347-30719369 CACTCAAGACTAGAGAGCTCAGG - Intronic
1124676005 15:31686334-31686356 CACTCAAGACTAGAGAGCTCAGG + Intronic
1132076142 15:98822273-98822295 CACTCAGGAAAACTTCGCCCGGG - Intronic
1132563200 16:608196-608218 CACTCAGCACTCATTCTCTCTGG - Intronic
1168658831 19:58150507-58150529 CTCTGAGGACGAGGTCGCTCCGG - Intronic
929814559 2:45220669-45220691 CACTCAGGACAAATTCATTCTGG - Intergenic
930731170 2:54729430-54729452 CACTCAGGAAATGTTAGCTCTGG - Intronic
933097031 2:78198000-78198022 CATTCAGTATTAGTTGGCTCTGG - Intergenic
1184848366 22:47102939-47102961 TACTCAGGGCTGGTTCCCTCAGG + Intronic
951960570 3:28314554-28314576 CACACAGGATTAGTTCCCTTTGG - Intronic
952768532 3:36976523-36976545 CATCCAGGACCAGATCGCTCTGG + Intergenic
965803378 3:172516955-172516977 CACTCAGTATGAGTTGGCTCTGG + Intronic
967505971 3:190253034-190253056 TTCTCAGAACTAGTTTGCTCAGG - Intergenic
986249548 5:6044098-6044120 CACTCAGCACTAGCATGCTCAGG - Intergenic
998667850 5:144318604-144318626 CATTCAGGACTATTTCCCTGAGG + Intronic
1002599881 5:180348022-180348044 CACACAGGACAGGTTGGCTCTGG + Intronic
1003094321 6:3130581-3130603 CACTTAGGACTAGGTGGGTCAGG + Intronic
1009007657 6:57807525-57807547 CACTCTGCACTAGTTTGCTAGGG - Intergenic
1035398534 7:158550408-158550430 CACTCAGGCCTAGTGCCCTGGGG - Intronic
1037139166 8:15498973-15498995 CTCTCAGGACTAGTTCCATAAGG - Intronic
1040593852 8:48819393-48819415 CACTCAGGACTGGGTGGCTCCGG - Intergenic
1047013696 8:120699848-120699870 CTCTCAGGACTTATTCTCTCAGG + Intronic
1051520872 9:17986402-17986424 TACTCAGGACTATTTCTATCTGG - Intergenic
1059331296 9:113537368-113537390 CACTCAGCTCTACTTGGCTCTGG - Intronic
1193731409 X:85107942-85107964 CACTCAGGACTAGTTCGCTCAGG + Exonic
1196639081 X:118037890-118037912 CAATCAGTCCTAGTTCACTCTGG - Intronic
1197630889 X:128856544-128856566 CACTGAGGACTAGTACTCTGGGG + Intergenic