ID: 1193731443

View in Genome Browser
Species Human (GRCh38)
Location X:85108180-85108202
Sequence CTGGATTATACCTGTTTGGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 105}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193731436_1193731443 11 Left 1193731436 X:85108146-85108168 CCATTTGGTTCATACCAAGTAAG 0: 1
1: 1
2: 2
3: 24
4: 1073
Right 1193731443 X:85108180-85108202 CTGGATTATACCTGTTTGGTTGG 0: 1
1: 0
2: 0
3: 7
4: 105
1193731440_1193731443 -3 Left 1193731440 X:85108160-85108182 CCAAGTAAGCTTGGGCTTGGCTG 0: 1
1: 0
2: 0
3: 12
4: 186
Right 1193731443 X:85108180-85108202 CTGGATTATACCTGTTTGGTTGG 0: 1
1: 0
2: 0
3: 7
4: 105
1193731435_1193731443 25 Left 1193731435 X:85108132-85108154 CCATTGGTTCATGTCCATTTGGT 0: 2
1: 0
2: 1
3: 12
4: 147
Right 1193731443 X:85108180-85108202 CTGGATTATACCTGTTTGGTTGG 0: 1
1: 0
2: 0
3: 7
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193731443 Original CRISPR CTGGATTATACCTGTTTGGT TGG Exonic
900552985 1:3265745-3265767 CTGGATAATGCCTGTCTGGCTGG - Intronic
900578575 1:3396237-3396259 GTGGATCCTACCTGTTTAGTCGG + Intronic
902693144 1:18123024-18123046 TTGGAAAATACCAGTTTGGTAGG + Intronic
903763533 1:25716581-25716603 GTGGCTTATGCCTGTTTGGGAGG - Intronic
905254353 1:36670566-36670588 TTGGATTGTTCCTGTGTGGTTGG + Intergenic
907479530 1:54735520-54735542 CTGGATTATGCATATTTGGCTGG + Intronic
910066974 1:83165607-83165629 CTTGATAATACCTGTCTTGTAGG - Intergenic
910813683 1:91265201-91265223 CTAGTTTTTACCTGTATGGTAGG - Intronic
912816300 1:112831418-112831440 CTGGATTATACCGGATATGTGGG + Intergenic
918529163 1:185499179-185499201 CTGGACTATATGTATTTGGTAGG - Intergenic
923417970 1:233783584-233783606 CAGAATTCTATCTGTTTGGTAGG + Intergenic
924482234 1:244446754-244446776 TTGGTTTATACATTTTTGGTTGG - Intronic
1062801042 10:380553-380575 ACGGATTATGCCTGTTTGGATGG - Intronic
1067733520 10:48831100-48831122 CTGGAATCTTCCTGCTTGGTTGG - Intronic
1078168953 11:8913772-8913794 CTGAAGTATTCCTCTTTGGTTGG - Intronic
1078429691 11:11279676-11279698 CTTTATTTTACCTGTTTGGGAGG - Intronic
1080634660 11:34113085-34113107 CTGGGTTATCACTGATTGGTAGG + Intronic
1083602567 11:63958061-63958083 CAGGGTTATACCTGTTCCGTGGG + Intergenic
1097637692 12:62142834-62142856 CTGGATTGTAACTATTTGCTGGG + Intronic
1099371901 12:81843960-81843982 GGGGATTATTCCTGTTTGGTAGG - Intergenic
1100957682 12:99926966-99926988 CTGGATTACAGTTGTTTGGCTGG + Intronic
1102196770 12:111031672-111031694 TTAGATTATACCTCTTTGGCAGG + Intergenic
1103384147 12:120518514-120518536 CTGGAGAATACCTAATTGGTTGG - Intronic
1103446645 12:120999378-120999400 CTGGACCTTACCTGCTTGGTGGG - Exonic
1103689264 12:122757797-122757819 TTGGATAATAACTGTTTGGAAGG + Intronic
1106862099 13:33920734-33920756 CTGCATTAAAAATGTTTGGTTGG - Intronic
1106908778 13:34439919-34439941 CTGGTTTATAGCTGGTGGGTTGG - Intergenic
1107581421 13:41792317-41792339 CTGGATTTTACCTTTTGTGTGGG + Intronic
1108677777 13:52752282-52752304 CTTGATTATACCTCATTGCTGGG + Intergenic
1110859842 13:80336669-80336691 CAAGATTATAACTGTTTAGTTGG + Exonic
1111430977 13:88147735-88147757 CAGGATTAAACCTGTTTCTTAGG - Intergenic
1111963943 13:94841755-94841777 CTTGATAAAATCTGTTTGGTGGG - Intergenic
1112656057 13:101453683-101453705 GTGGGTGATACCTGTTTGCTTGG + Intronic
1113014972 13:105818385-105818407 GTGGATTATACCTAATTGGCTGG + Intergenic
1113229608 13:108197741-108197763 CTGGATAATTCCTGTTTGTGGGG + Intergenic
1114889753 14:26904034-26904056 CTGTATTTTTCCTGTCTGGTTGG + Intergenic
1116067128 14:39998521-39998543 CTGGATTATGCTTGTCTAGTTGG + Intergenic
1119875897 14:78059098-78059120 CTGGATGATTTCAGTTTGGTCGG - Intergenic
1125866630 15:43056858-43056880 CTGGATTCAATCTGATTGGTTGG - Intronic
1126745214 15:51819002-51819024 CTGGTTTACACCTGTTTTATTGG + Intergenic
1126749119 15:51858474-51858496 CTGGTGTATACCTGTTTTATTGG - Intronic
1129014625 15:72455590-72455612 CTGGCCTTTAACTGTTTGGTAGG + Intergenic
1129574612 15:76728976-76728998 CTGTGTTATACTTGTTTTGTGGG + Intronic
1134235329 16:12460608-12460630 CTGGACTATAACTTTTTGGCTGG + Intronic
1137067548 16:35863965-35863987 CTGGATGATAGTTGTTTGGGAGG + Intergenic
1146427796 17:32759999-32760021 CTGGTTTATATCTGTCTGTTAGG - Intronic
1148948567 17:51287847-51287869 CTGTTTTCAACCTGTTTGGTTGG + Intronic
1148971438 17:51486327-51486349 CTGTTTTATATCTGGTTGGTTGG + Intergenic
1155055077 18:22175169-22175191 CAGGATTATAGCTGCCTGGTGGG + Intronic
1155653252 18:28166119-28166141 CTGAATTACTCCTCTTTGGTAGG - Intronic
1165112540 19:33510806-33510828 CTGGAGTATGACTGTGTGGTAGG - Intronic
926156949 2:10461030-10461052 CTAGAATAAACCTGCTTGGTGGG - Intergenic
928751940 2:34480723-34480745 CTAGATTAAACCTATTTGCTGGG + Intergenic
930816852 2:55607384-55607406 CTGATTTATAGCCGTTTGGTTGG - Intronic
936725150 2:115305256-115305278 CAGGATCATACCTGTTCTGTTGG + Intronic
937110639 2:119364621-119364643 CTGGCTTATGTGTGTTTGGTGGG + Intronic
1170522934 20:17207027-17207049 CTGCATTATTCCTGTCTCGTTGG - Intergenic
1173421802 20:42907886-42907908 ATGGTTTATTTCTGTTTGGTGGG - Intronic
1179038696 21:37782816-37782838 CTGGATTATGCCTGTTGTCTTGG + Intronic
1181543868 22:23589781-23589803 CTTGGTGTTACCTGTTTGGTGGG + Intergenic
1184429762 22:44435182-44435204 CTGGAGCAGACTTGTTTGGTTGG + Intergenic
950393510 3:12715697-12715719 CTGGATTATTTTTGTTTGGTTGG + Intergenic
955248715 3:57255123-57255145 CTGGGTTCTACCTGTATGTTTGG - Intronic
956192779 3:66622973-66622995 CTGGCTTATACCTTTTTAGGAGG + Intergenic
956693421 3:71898657-71898679 TTGGCTTATACTTGTTTGCTGGG + Intergenic
956961797 3:74411463-74411485 CTGGATTATTCCTCTTTGATAGG + Intronic
960110068 3:113837280-113837302 CTTTTTTATAGCTGTTTGGTTGG + Intronic
961064038 3:123858879-123858901 CTGGATGAAGCCAGTTTGGTAGG - Intronic
962762480 3:138527895-138527917 CTGGATTATAACTGTTTCATAGG + Intronic
969635344 4:8365932-8365954 CTGGGTTACATCTGTTTGATGGG + Intergenic
971211445 4:24621693-24621715 CTGGATTATACCAGATATGTGGG - Intergenic
974570344 4:63638203-63638225 AAGGAGTATACCTGTTTGCTTGG - Intergenic
978587578 4:110290422-110290444 CTGGATTGACCCTGTTGGGTGGG - Intergenic
980694662 4:136339101-136339123 CTGGATATTACATTTTTGGTTGG - Intergenic
981479718 4:145225706-145225728 CTGGATTTTTTCTGGTTGGTAGG + Intergenic
991675825 5:69089121-69089143 CTGGATTATACTGGTTATGTAGG - Intergenic
996086127 5:119306758-119306780 ATGGTTTATACTTGGTTGGTTGG + Intronic
1000119197 5:158180488-158180510 CTGGATGATGCCTGTTTTATGGG - Intergenic
1002406375 5:179036416-179036438 CTGGATTATAGTAGTTTTGTTGG - Intergenic
1003006318 6:2385676-2385698 CTGGCTTACGTCTGTTTGGTCGG - Intergenic
1003123919 6:3340106-3340128 CTGGATAATACCGCTTTTGTGGG - Intronic
1004679339 6:17877420-17877442 CTGGATTACGCCTGTGTGGTCGG - Intronic
1004765373 6:18720962-18720984 CTGGCTTATACATGTGTGTTAGG + Intergenic
1005703892 6:28431354-28431376 CTGGTTTATACCTGTTGTCTTGG + Intergenic
1006736444 6:36276907-36276929 TTGTATTATAACTGTTTGGTAGG - Intronic
1007041257 6:38724584-38724606 CTGGATTATACCTATTTTCCTGG + Intronic
1008123822 6:47646843-47646865 CTGGATTATACCGGATATGTGGG + Intergenic
1010500349 6:76592536-76592558 CTGTCTTATACCTTGTTGGTGGG + Intergenic
1015174851 6:130295802-130295824 CTGCATTATACCTGCTTTCTAGG + Intronic
1015940334 6:138444016-138444038 CTGGATTATACATTTTTTGAGGG + Intronic
1021402725 7:20228133-20228155 TTAGATAATACCTGTTTTGTAGG - Intergenic
1021560992 7:21968532-21968554 CAGGATTTTACCAGGTTGGTCGG - Intergenic
1022839109 7:34145672-34145694 CTGCATTATACCAGGATGGTTGG - Intronic
1027277135 7:76569151-76569173 CTTGATAATACCTGTCTTGTAGG + Intergenic
1028929914 7:96401585-96401607 ATGGATTATGCATGGTTGGTTGG - Intergenic
1029236990 7:99128788-99128810 CTTGAATAAACCTGTTTGGGAGG - Intronic
1030553916 7:110999348-110999370 CTGGATTGTACCTCTTTTATTGG + Intronic
1030698187 7:112608873-112608895 CTGGATTATACCTGAGGAGTTGG + Intergenic
1032967893 7:137122439-137122461 CTCAATTATCCCTGTTTTGTTGG + Intergenic
1037680186 8:21090679-21090701 CTGGATTATTGCTGTTTCTTTGG - Intergenic
1037789392 8:21923400-21923422 CCTGATTATACCTCTTTCGTGGG + Intronic
1043210721 8:77512844-77512866 ATGGTTTATACATCTTTGGTTGG - Intergenic
1046228920 8:111327155-111327177 CTGGCTTATACGTATTTGTTTGG - Intergenic
1051078979 9:13274731-13274753 CTGTCTTATACGTGTTTTGTGGG - Intronic
1053464925 9:38298990-38299012 ATGGATACTACCTGGTTGGTGGG + Intergenic
1057417246 9:94875731-94875753 CAGAATTCCACCTGTTTGGTCGG + Intronic
1061711732 9:132492726-132492748 CAGGATTATAGATGTTTGATGGG + Intronic
1191917613 X:66219831-66219853 CTGGATTATACTGGATTTGTGGG - Intronic
1192598205 X:72433851-72433873 CAGGATTATACCAGTTTCATTGG + Intronic
1193731443 X:85108180-85108202 CTGGATTATACCTGTTTGGTTGG + Exonic
1193907080 X:87257098-87257120 CTGGATTTTTTTTGTTTGGTAGG - Intergenic
1199688660 X:150289135-150289157 CTGGATTATACATTGTTGGTGGG + Intergenic
1200978414 Y:9238547-9238569 CTTGCTGATACCAGTTTGGTCGG - Intergenic