ID: 1193731804

View in Genome Browser
Species Human (GRCh38)
Location X:85110955-85110977
Sequence GTAAAGAAACAGATTGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193731801_1193731804 -10 Left 1193731801 X:85110942-85110964 CCCCATTTTTCAAGTAAAGAAAC No data
Right 1193731804 X:85110955-85110977 GTAAAGAAACAGATTGAGAGAGG No data
1193731800_1193731804 15 Left 1193731800 X:85110917-85110939 CCAATGAGGTAGGAGATAGTCTT No data
Right 1193731804 X:85110955-85110977 GTAAAGAAACAGATTGAGAGAGG No data
1193731798_1193731804 27 Left 1193731798 X:85110905-85110927 CCTCATAACAATCCAATGAGGTA No data
Right 1193731804 X:85110955-85110977 GTAAAGAAACAGATTGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193731804 Original CRISPR GTAAAGAAACAGATTGAGAG AGG Intergenic
No off target data available for this crispr