ID: 1193738353

View in Genome Browser
Species Human (GRCh38)
Location X:85186634-85186656
Sequence AAAGAGACCACAGTGACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193738353_1193738358 14 Left 1193738353 X:85186634-85186656 CCCACAGTCACTGTGGTCTCTTT No data
Right 1193738358 X:85186671-85186693 GATTTTCTTTCTTCAGCATATGG No data
1193738353_1193738359 27 Left 1193738353 X:85186634-85186656 CCCACAGTCACTGTGGTCTCTTT No data
Right 1193738359 X:85186684-85186706 CAGCATATGGTAGCTGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193738353 Original CRISPR AAAGAGACCACAGTGACTGT GGG (reversed) Intergenic
No off target data available for this crispr