ID: 1193741878

View in Genome Browser
Species Human (GRCh38)
Location X:85226825-85226847
Sequence GGGTGCTAAAAGGAGTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193741878_1193741884 22 Left 1193741878 X:85226825-85226847 CCAGCACACTCCTTTTAGCACCC No data
Right 1193741884 X:85226870-85226892 TTTATAAGATATGCATTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193741878 Original CRISPR GGGTGCTAAAAGGAGTGTGC TGG (reversed) Intergenic
No off target data available for this crispr