ID: 1193743225

View in Genome Browser
Species Human (GRCh38)
Location X:85243868-85243890
Sequence TCTCGCGCACGCGCGCGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 70}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193743225_1193743234 9 Left 1193743225 X:85243868-85243890 CCCGCGCGCGCGCGTGCGCGAGA 0: 1
1: 0
2: 1
3: 16
4: 70
Right 1193743234 X:85243900-85243922 GGCCCCCTACCCTGCAGCAAGGG 0: 1
1: 0
2: 2
3: 12
4: 163
1193743225_1193743233 8 Left 1193743225 X:85243868-85243890 CCCGCGCGCGCGCGTGCGCGAGA 0: 1
1: 0
2: 1
3: 16
4: 70
Right 1193743233 X:85243899-85243921 TGGCCCCCTACCCTGCAGCAAGG 0: 1
1: 0
2: 2
3: 20
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193743225 Original CRISPR TCTCGCGCACGCGCGCGCGC GGG (reversed) Intergenic