ID: 1193748288

View in Genome Browser
Species Human (GRCh38)
Location X:85310906-85310928
Sequence CATGAAGCCCAGAAGGAACT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 281}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193748288 Original CRISPR CATGAAGCCCAGAAGGAACT AGG Intronic
900087662 1:906093-906115 CAGGAGGCCCAGAAGGAGCGGGG - Intergenic
900162351 1:1230060-1230082 CATGTATCCCAAAGGGAACTCGG + Intronic
901019323 1:6247987-6248009 CCTGAGGGCCAGAAGGAACTGGG + Exonic
903516690 1:23916006-23916028 AAAGAAGACCAGAAGGAGCTGGG + Intergenic
904366902 1:30017562-30017584 CATAAAGGCCAGAAGGCAGTAGG - Intergenic
904485459 1:30822067-30822089 CGTGGAGGCCAGAAGGAGCTGGG - Intergenic
906892877 1:49737728-49737750 CATGAAAACCAGAAGGCAGTAGG + Intronic
907987955 1:59551686-59551708 CATGCAGCTCACAAGGAACTGGG - Intronic
908392806 1:63698862-63698884 CATGGAGCCCTCAAGGAACATGG + Intergenic
909740273 1:79020109-79020131 CAAGAAGCCAAGAAGAAATTAGG - Intergenic
910085737 1:83400100-83400122 CATTCAGCTCAAAAGGAACTTGG - Intergenic
913377897 1:118174783-118174805 CCTGCAGGCCAGAAGGCACTGGG + Intronic
916011411 1:160709479-160709501 CATGGAACCCAGATAGAACTAGG + Intronic
916254172 1:162769466-162769488 CATGAAGCTCAGAACAAAGTAGG - Intronic
917233705 1:172866351-172866373 CACGAAGCCCAGATGGAGCTGGG + Intergenic
919256270 1:195128727-195128749 CATGAAGCCCACAAAGGCCTGGG + Intergenic
920112761 1:203598737-203598759 CTTGAAGGCAGGAAGGAACTTGG - Intergenic
921482429 1:215678413-215678435 CCTGAAGCCAGGAATGAACTTGG - Intronic
921794473 1:219326527-219326549 CAAGAATCCCAGAAGGGAATTGG - Intergenic
921815867 1:219562715-219562737 CATGCATCATAGAAGGAACTGGG + Intergenic
922853489 1:228754880-228754902 CAGGAGGCTCAGAATGAACTGGG + Intergenic
924066347 1:240226356-240226378 AATGAAGACCAGAAGGCAGTAGG + Intronic
924226424 1:241925851-241925873 CATGAATCCCAGAAGCAACAAGG - Intergenic
924607991 1:245551699-245551721 CCGGAAGCCCAGAAGGAAGTTGG + Intronic
1063066392 10:2613849-2613871 AATGAAGGCCAGAAGGCAGTAGG + Intergenic
1063976903 10:11424656-11424678 CATGACGTCCAGAGGGAACTGGG - Intergenic
1064201001 10:13284836-13284858 CGTCATTCCCAGAAGGAACTGGG - Intronic
1064348703 10:14556971-14556993 CATGCAGCCCAGAAAGAGTTTGG - Intronic
1065727498 10:28679863-28679885 CTTGAAGCAGAGAAGGAACTTGG + Intronic
1067149993 10:43723849-43723871 CGAGAAGCTAAGAAGGAACTGGG + Intergenic
1067563238 10:47318777-47318799 CAAGAACCCCAGAAGGGTCTAGG - Intergenic
1067796818 10:49326995-49327017 CATAAAGTCCAGAAGGCAGTAGG + Exonic
1067841671 10:49685661-49685683 CATGGAGGCCAGAAGGCAGTGGG - Intronic
1069701027 10:70426062-70426084 CAAGAAGCCCAGGAAGAAATGGG - Exonic
1069721420 10:70551951-70551973 CACGAAGCCCAGAAGGAAACGGG - Intronic
1071133788 10:82429449-82429471 CATGGAGTCCAGAAGGCAATGGG - Intronic
1071166172 10:82810181-82810203 CATGAAGCACACAAAGAATTAGG - Intronic
1071475380 10:86020805-86020827 CATCAAACCCACAAGGAACCAGG - Intronic
1072459313 10:95604876-95604898 CATGAAGGCCATCAGGCACTGGG - Intergenic
1074187887 10:111112916-111112938 CCTGAAGGACTGAAGGAACTGGG + Intergenic
1074862601 10:117523778-117523800 CATGAAGACCAGAAGCCACTGGG + Intergenic
1079483242 11:20906104-20906126 CATGGAGACCAGAAGGCAATGGG + Intronic
1080235355 11:30062320-30062342 CATGGAGGCCAGAAGGAAGTGGG + Intergenic
1081592391 11:44433617-44433639 CATGAAGCCCAAAACTCACTTGG + Intergenic
1081739172 11:45426083-45426105 CATGAAACCCAGCTGGAACTGGG - Intergenic
1083476890 11:62920916-62920938 CCTGAGGCCCAGAAGGGATTAGG - Intronic
1083765087 11:64837893-64837915 CATGTGGCCCAGCAGGACCTGGG + Intronic
1086144474 11:83536481-83536503 CATGCATCCCAGAAAGAGCTAGG - Intronic
1087904747 11:103682559-103682581 CAAGAAGCACGGAAGGAGCTGGG + Intergenic
1089669829 11:120046654-120046676 TATGGAGGCCAGAAGGAAATAGG + Intergenic
1090080488 11:123609241-123609263 CATGCAGCTAAGAAGGAGCTAGG + Intronic
1091157160 11:133384632-133384654 AATGAGGCACAGAAGGCACTGGG - Intronic
1091232491 11:133997847-133997869 AAGGAAGCCCAAAAGGAACTGGG - Intergenic
1091249653 11:134132245-134132267 CTTGGAGGCCAGAAGGAAGTGGG + Intronic
1092053342 12:5489140-5489162 CATCAGGCCCAGGAGGGACTAGG + Intronic
1092498923 12:9026454-9026476 CATGGAGCTGAGAAGGACCTAGG - Intergenic
1096103934 12:48985832-48985854 CCTGAGGCCCAGGAGGAAGTGGG + Intergenic
1096619382 12:52853294-52853316 GATGAAGGCCAGAAGGAGATGGG - Intergenic
1096893421 12:54795186-54795208 GATGAGGCCCATAAGAAACTTGG + Intergenic
1100227291 12:92572044-92572066 CATGAAGCCCACAGGGACCAGGG + Intergenic
1100520812 12:95373959-95373981 CATGAAGTCCAGAAGGGGGTTGG + Intergenic
1103535791 12:121633096-121633118 CATGGAGCCCAGCAGGAGCCAGG + Intronic
1104271211 12:127284153-127284175 CATGAAACCCAGCATGACCTGGG + Intergenic
1105917424 13:24929448-24929470 CATGGAGGCCAGAAGGCAGTGGG - Intergenic
1106375727 13:29185600-29185622 CATGAAGGCCAGAAAGCAGTGGG + Intronic
1106633278 13:31499871-31499893 CATGAAGGCCAGAAGAGAGTGGG + Intergenic
1108204969 13:48079109-48079131 ACTGAAGCTCAGAATGAACTGGG + Intronic
1109067849 13:57722993-57723015 CATGAAGAACAGCAGAAACTAGG - Intronic
1109485806 13:63017216-63017238 CATGGAGAGCAGAAGGAATTAGG + Intergenic
1109814185 13:67557858-67557880 CATGGAGGCCAGAAGGTAGTTGG + Intergenic
1109923906 13:69108085-69108107 CATATAGCCCAGAAGGGAATGGG + Intergenic
1110263980 13:73517818-73517840 CATGAAGCCAAAAATGCACTTGG - Intergenic
1110342526 13:74409556-74409578 CAAGAAGCCCAGAGGCAACAGGG + Intergenic
1111596140 13:90413418-90413440 CATGAAGCCCAGGAGATAATAGG + Intergenic
1111823294 13:93239198-93239220 CATGAAGCCCAGGACCAGCTAGG - Intronic
1114406769 14:22464087-22464109 CTTGCAGGCCAGAAAGAACTAGG + Intergenic
1115695634 14:35895616-35895638 AATCAATACCAGAAGGAACTTGG - Intronic
1118111722 14:62728844-62728866 GATAAAGCCTAGAAGGAACGGGG + Intronic
1118785631 14:69043457-69043479 CACAATGCCCAGTAGGAACTGGG - Intergenic
1119640443 14:76310540-76310562 CATGAAGGGGAGGAGGAACTGGG - Intergenic
1121309506 14:92928027-92928049 CATCAAGCCTGGAAGGAGCTGGG - Intronic
1121466120 14:94116466-94116488 AATGGAGCCCAGGATGAACTTGG - Exonic
1123216022 14:106810065-106810087 GAGGAAGCCCAGGAGGACCTGGG - Intergenic
1124087342 15:26563267-26563289 AATGAACCCCAGAGGGACCTGGG + Intronic
1124152545 15:27194583-27194605 CATGAATGCTAGAAGGAAATTGG - Intronic
1124245204 15:28064117-28064139 CATGGAGGCCAGAAGGCAGTGGG - Intronic
1128296109 15:66521218-66521240 CATGAACCCGAAAAGGAAATAGG - Intronic
1129324926 15:74794816-74794838 CATGGAGAGCAGAAGGAGCTGGG - Intronic
1130357928 15:83152179-83152201 CTGGAAGACCAGAAGTAACTTGG - Intronic
1131715104 15:95101041-95101063 CATGAAGCCCAGAAGGCAGTGGG + Intergenic
1134432568 16:14224653-14224675 CTTGAAGACCAGAAGGCAGTGGG + Intronic
1135334945 16:21593355-21593377 CCTGTAGTCCAGGAGGAACTTGG + Intergenic
1137321559 16:47388521-47388543 AATGAAGACCAGAAGGCAGTGGG + Intronic
1138628472 16:58273004-58273026 AATGAAGGCCAGAAGGCAATGGG - Intronic
1138841153 16:60508309-60508331 CAAGAAGGCTAGAAGGATCTGGG - Intergenic
1139766926 16:69238330-69238352 CATGTAGGCCTGAAGGAAATAGG - Intronic
1140177114 16:72673404-72673426 TATGGAGGCCAGAAGGAAGTGGG + Intergenic
1140180309 16:72709825-72709847 CATGAAGCCCAGGGGAAAATTGG + Intergenic
1140717033 16:77735909-77735931 CGGGAAGCCCAGGAGGAAGTGGG + Exonic
1143058206 17:4178238-4178260 CATGAAGGTGAGATGGAACTTGG - Intronic
1144487806 17:15682019-15682041 AATGAAGCCCAGAAGAAACTTGG - Intronic
1144913216 17:18700272-18700294 ACTGAAGCCCAGAAGAAACTTGG + Intronic
1146518883 17:33510902-33510924 CATGACCCCCAGGAGGAGCTGGG - Intronic
1148330876 17:46813275-46813297 AATGAAGCCCAGAAGGAGGCAGG + Intronic
1148738014 17:49875715-49875737 CAAGAGGGCCAGAAGGAGCTGGG + Intergenic
1148862820 17:50613416-50613438 CAAGAGGCCCAGAAGGAAGGCGG - Intronic
1149169466 17:53792230-53792252 CATGAACCCCACCTGGAACTGGG - Intergenic
1150838943 17:68590479-68590501 CATGAACCCGTGAAGGAGCTGGG + Intronic
1153687231 18:7558285-7558307 CACAAAGCCAGGAAGGAACTAGG - Intergenic
1154042323 18:10868463-10868485 CAGGTAGCCCAGGAGGAACAGGG - Intronic
1155320830 18:24617336-24617358 CCTAATGCCCAGAAGGCACTTGG - Intergenic
1159270455 18:66142391-66142413 CATGAAGACCTGAAGGATCACGG + Intergenic
1159991791 18:74917251-74917273 CATGCAGACAAGAAGGAACTGGG - Intronic
1160271674 18:77392058-77392080 CATGAAGGCCAGAAGACAGTAGG - Intergenic
1160352381 18:78194683-78194705 CATGAAGCTCAGGAGGAAACTGG - Intergenic
1160556032 18:79725843-79725865 CACGGAGCCCAGAAGGAAGCCGG - Intronic
1161494365 19:4579532-4579554 ACTGAAGCCCAGAAAGGACTAGG + Intergenic
1162376523 19:10308533-10308555 CATGCAGGCCAGAGGGACCTGGG + Exonic
1162709860 19:12584768-12584790 CATGTTGCCCTGAAGGATCTCGG + Intronic
1163958146 19:20662865-20662887 CATGAGGCCCAGTTGCAACTGGG - Intronic
1164421450 19:28096884-28096906 CATGAAGCCCTAAGGGGACTTGG - Intergenic
1165548030 19:36558499-36558521 AATGAAGGCCAGAAGGCAGTGGG + Intronic
1167655166 19:50759029-50759051 CAGGAAGCCCAGCAGGAAGTGGG - Intergenic
926043118 2:9690586-9690608 CATGCTGGCCAGAAGGAGCTGGG + Intergenic
927072156 2:19542115-19542137 CCTGAAACCCAGGAGGATCTTGG - Intergenic
928275165 2:29894137-29894159 CAAGAAACCCAGAGAGAACTTGG + Intronic
928847185 2:35690708-35690730 GATGAAGCACAAAAGGAACTGGG - Intergenic
928887773 2:36169555-36169577 CATTAATTCCACAAGGAACTAGG + Intergenic
929177637 2:38997635-38997657 CATGGAGGCCAGAAGGCAGTGGG + Intronic
929716015 2:44310459-44310481 CATGAAGGCCAGAGGGCAATGGG - Intronic
930449371 2:51514914-51514936 CATGAATCACAGAAGTAATTTGG + Intergenic
931407558 2:61994661-61994683 CAGGAAGGCCTGCAGGAACTAGG + Intronic
931804219 2:65788858-65788880 CATCAAGCCCAGCAGGAGCCAGG + Intergenic
932010734 2:67975092-67975114 AATGGAGCCCAAGAGGAACTTGG - Intergenic
932837322 2:75049705-75049727 CTTGAAGCCCAGACGGAACCTGG + Exonic
936643906 2:114347374-114347396 AATGAAGTCCAGAGGCAACTAGG - Intergenic
937037882 2:118796844-118796866 CCTGAAGTCCAAAAGGAATTTGG - Intergenic
937195784 2:120155326-120155348 CATGCAGACCAGAAGGCAATGGG - Intronic
937372291 2:121307734-121307756 CATGCAGGCCAGAAGGCAATGGG + Intergenic
938294073 2:130166439-130166461 CATGATGCCCAGATGGCTCTTGG - Intronic
938462573 2:131507447-131507469 CATGATGCCCAGATGGCTCTTGG + Intergenic
938464605 2:131517762-131517784 CAGGAAGCCCACAACCAACTTGG - Intergenic
938987665 2:136595020-136595042 CTTGAAGGCCAGAAGGTAGTGGG - Intergenic
939334030 2:140802028-140802050 CCTTAAGCTCAGAGGGAACTGGG - Intronic
940985852 2:160051466-160051488 GATGCAGTCCAGAAGGAAATGGG + Intronic
942057009 2:172193447-172193469 CATGGAGGCCAGAAGGCAGTGGG - Intergenic
943322571 2:186463710-186463732 TATGAAGAACAGAAGGACCTTGG + Intergenic
945129299 2:206551098-206551120 CCTGAAGCCCAGAAGAGTCTTGG + Intronic
947035993 2:225856499-225856521 CATGAAGGCCAGAAAGAAGCAGG - Intergenic
947508247 2:230726603-230726625 CATGTAGGCAGGAAGGAACTAGG + Intronic
948516856 2:238509555-238509577 CATGCAGCCCAGAAGCAGCCTGG - Intergenic
948911332 2:241004639-241004661 CATGAGGGCCAGAAGGAAAATGG - Intronic
1169684193 20:8251981-8252003 TAGGAAGCCCTGAAGGACCTAGG + Intronic
1170117783 20:12879199-12879221 AATGCAGCCCAAAAGGAAGTGGG + Intergenic
1170854596 20:20039376-20039398 GATGATGCCCAGGATGAACTGGG - Intronic
1172205717 20:33161600-33161622 GATGAACCCCAGAGAGAACTTGG + Intergenic
1172766390 20:37353394-37353416 CACGCAGCCCTGAAGGGACTTGG + Intronic
1174814294 20:53673557-53673579 TATGAAGCAGAGAAGCAACTTGG - Intergenic
1176100687 20:63363116-63363138 CATGTAGGCCAGAAGGACCAGGG - Intronic
1176168414 20:63686318-63686340 CAGGAAGCCAAGAAGGCACGTGG - Intronic
1176923082 21:14712558-14712580 CATGGAGGCCGGAAGGCACTGGG + Intergenic
1177923715 21:27187111-27187133 CATGAAGCCCAAAAGAAATCTGG + Intergenic
1178276573 21:31243801-31243823 CATGAAGGCCAGAAAGCAGTGGG + Intronic
1179169555 21:38962414-38962436 CAGGATGCCCAGCAGGAAGTGGG - Intergenic
1179940071 21:44632308-44632330 CATGAAGAACAGAAGGCAATGGG + Intronic
1180610634 22:17095435-17095457 CATGAAGACCACAAGGAAAGTGG - Intronic
1180703085 22:17792357-17792379 CAGGAAGCCCAGGAGCAGCTTGG - Intronic
1181856571 22:25785405-25785427 CTGGAAGCACAGAAGGAACCAGG - Intronic
1182083881 22:27548247-27548269 CATGAACCCCAGAAAGGACCAGG + Intergenic
1182527176 22:30927719-30927741 CATGACGCCCAGATGGGATTGGG - Intronic
1182559400 22:31147956-31147978 AATGAAGCCCCAAAGGACCTTGG + Intergenic
1182787460 22:32919662-32919684 CAGGAAGCCCAGAAGAATCTGGG + Intronic
1183509431 22:38226394-38226416 CACTAAGCCCAGAATGAAATGGG + Intronic
1184681605 22:46075125-46075147 CGTGTGGCCCAGGAGGAACTGGG + Intronic
1184803069 22:46774296-46774318 CAGGAGGCCCAGAGGGAACAGGG + Intronic
949607240 3:5666675-5666697 AATGAAGGCCAGAAGGCACTGGG + Intergenic
950225876 3:11234232-11234254 AATGAAGGCCACAAGGCACTGGG - Intronic
950608989 3:14112866-14112888 AATGAAGGCCACAAGGCACTGGG - Exonic
950740808 3:15050494-15050516 GATGAAAGCCAAAAGGAACTAGG + Exonic
951046106 3:18040495-18040517 GTTGAAACCCAAAAGGAACTTGG + Intronic
951129724 3:19027775-19027797 AATGAAGCCCAGAAGGCAATAGG + Intergenic
952055489 3:29439952-29439974 CAGGAAGACCAGACGGAAGTCGG + Intronic
952408432 3:33026088-33026110 CATGGAGCCAAGCAGGAGCTGGG + Intronic
952481131 3:33762645-33762667 CATGCAGGCCAAAAGGAAGTGGG - Intergenic
952974034 3:38679047-38679069 CAGGATGCCCAGAAGGACCAAGG + Intergenic
953230953 3:41064628-41064650 CATGAAGCCAACAAGGACTTGGG - Intergenic
953935430 3:47037697-47037719 CATGAAGCTGAGATGGACCTGGG - Exonic
954041630 3:47892090-47892112 TATGAGTCCCAGATGGAACTCGG + Intronic
954043869 3:47912157-47912179 CTTGAACCCCAGAGGGATCTTGG - Intronic
955889727 3:63637110-63637132 CATGGAGGCCAGGAGGAAATGGG + Intergenic
955956873 3:64299456-64299478 CATGAAGGCCAGAAAGTAGTGGG + Intronic
957524618 3:81363759-81363781 CTAGAATCCCAGAAGGAATTTGG + Intergenic
958254682 3:91311932-91311954 CATGAAGACCAGAAGAAAATGGG + Intergenic
960589722 3:119353854-119353876 CAAGAAGCCAAGAAGGGAATGGG - Intronic
960653606 3:119978884-119978906 CATCAAGCTGAGAAGAAACTGGG - Intronic
964521081 3:157568095-157568117 CTTGCAGGCCAGAAGGAAGTGGG - Intronic
965653062 3:170953592-170953614 GACGGAGCCCAGAAGGATCTCGG - Intergenic
965901242 3:173644541-173644563 CATGAAGTCAAAATGGAACTGGG - Intronic
967380065 3:188847918-188847940 CATGAAGCAGAGCTGGAACTAGG + Intronic
967464887 3:189793145-189793167 CCTCGAGCCCAGAGGGAACTAGG + Intronic
968225047 3:196968218-196968240 CACGAAGCCGAGAAGAATCTCGG - Intronic
969164892 4:5299055-5299077 CAGGAAGCCCAGAAGGGGCTGGG - Intronic
969314829 4:6375609-6375631 CAAGAAGCCTAGAAGAAACGTGG + Intronic
969485583 4:7470758-7470780 CATGGAGCCCACAAGGCAGTGGG + Intronic
971648633 4:29241645-29241667 CAAGAACCCAAGAAGGAATTGGG - Intergenic
973056206 4:45661853-45661875 CAAGAAGCACAGAAGCAAGTAGG - Intergenic
973755500 4:54069522-54069544 CATAAAACCCTGAAGGAACAGGG - Intronic
973853525 4:54986653-54986675 AATGAATCCCAGAAGCAACGTGG - Intergenic
975418367 4:74133141-74133163 CATGTAGGCCAGAAGGAAATAGG - Intronic
977687553 4:99865670-99865692 CATGAACCACAAAAGGATCTAGG + Intronic
977882286 4:102218800-102218822 CATGGAGACCAGAAGCTACTCGG - Intergenic
978003325 4:103584386-103584408 TATGAAGGCCAGAAGGCAATGGG - Intergenic
979874960 4:125876947-125876969 TATGAAGGCCAGAAGGCAGTAGG + Intergenic
979949274 4:126872646-126872668 CATCAAGACCAGAAGGAAATGGG + Intergenic
981565362 4:146095910-146095932 CATGAAGCAAAGAAAGAAGTTGG + Intergenic
983326394 4:166262893-166262915 CATGAAGACCAGAAGCAAGCTGG - Intergenic
984369564 4:178845215-178845237 CATGGAGGCCAGAAGGCAGTGGG + Intergenic
986146332 5:5081244-5081266 CATGAAGCCCTGCAGGCACATGG - Intergenic
986503576 5:8427170-8427192 CATGAGATTCAGAAGGAACTGGG + Intergenic
988524432 5:31974688-31974710 CATACTGCCCTGAAGGAACTGGG - Intronic
989189286 5:38654644-38654666 AATGAAGCCAAGAAGAAACAAGG + Intergenic
990915346 5:60897012-60897034 GATGAGGAACAGAAGGAACTAGG - Intronic
991402548 5:66268835-66268857 CATGGAGGCCAGAAGGCAGTGGG - Intergenic
991566869 5:68014423-68014445 ACTGAAGCCCAGAAGACACTCGG - Intergenic
991974597 5:72173838-72173860 CACCACGCCCAGCAGGAACTAGG - Intronic
992094334 5:73347240-73347262 CATGGAGGCCAGAAGGCAGTAGG + Intergenic
993188595 5:84652362-84652384 CATTGAGCCCTGAAGGAAATTGG - Intergenic
993189182 5:84659324-84659346 CATTGAGCCCTGAAGGAAATTGG - Intergenic
993248454 5:85483498-85483520 CATATAAGCCAGAAGGAACTTGG - Intergenic
993754392 5:91709886-91709908 CATGAAGGCCAAAAGGCAATAGG - Intergenic
995105466 5:108372591-108372613 CATGGAGACCAGAAGGCAGTGGG + Intronic
995160805 5:108978744-108978766 CATGAAGCCCAAAACGATCTAGG + Intronic
997764706 5:136489448-136489470 CATGGAGACCAGAAGGCAGTGGG - Intergenic
1001143340 5:169163401-169163423 CATGAAGCCCAGGTTGAACTGGG + Intronic
1003389958 6:5705285-5705307 CATGAAGTCGAGAAGAAACATGG - Intronic
1004084102 6:12427306-12427328 CATGAAGCAAAGAAAGAGCTTGG - Intergenic
1004127937 6:12891551-12891573 CATGAAAACCAGAAGTAACCTGG - Intronic
1006177064 6:32128801-32128823 CGGGCAGCCCAGGAGGAACTGGG - Exonic
1009769564 6:68127493-68127515 CATGGAGGACAGAAGGAAGTAGG - Intergenic
1009910995 6:69926938-69926960 CATGGAGACCAGAAGGCAGTGGG + Intronic
1009975405 6:70666454-70666476 CATGAAGACCTGAAGTACCTTGG - Intergenic
1010845342 6:80700680-80700702 CATGGAGGCCAGAAGGCATTGGG - Intergenic
1011176685 6:84569307-84569329 CAAGGAACCCAGAAGGAATTTGG + Intergenic
1011350668 6:86419991-86420013 GATGAAGCAGTGAAGGAACTAGG - Intergenic
1011841535 6:91507003-91507025 CATGAGGCCAAGAAGAAAGTTGG - Intergenic
1013732800 6:113188690-113188712 AATGAAGTCCAGAAGAAACGAGG - Intergenic
1016775708 6:147902597-147902619 CATTAATCGCAGAAGTAACTAGG - Intergenic
1017433052 6:154390340-154390362 CATAAAGGGCAGGAGGAACTAGG - Exonic
1017835479 6:158173677-158173699 CATGAAGCCAAAAACCAACTTGG - Intronic
1017932404 6:158969332-158969354 CATGAAGGCCAAAAGGCAATGGG - Intergenic
1023906474 7:44525836-44525858 CTTGAAGCCCAGATGGCAGTGGG + Intronic
1024097604 7:45996403-45996425 CATGAAGGGCAGAAGGAAGTGGG + Intergenic
1024674113 7:51622847-51622869 CAAGAAGGCCAAAAGGAAATAGG + Intergenic
1026065638 7:67070053-67070075 CATGGAGGCCAGAAGGCAGTGGG - Intronic
1026351928 7:69524681-69524703 CATGGAGCCCAGAAGGCAGTGGG - Intergenic
1026711237 7:72741807-72741829 CATGGAGGCCAGAAGGCAGTGGG + Intronic
1027302615 7:76856561-76856583 CATTCAGCTCAAAAGGAACTTGG - Intergenic
1028250330 7:88532499-88532521 CATGAGTCCCTGAAGGTACTAGG - Intergenic
1028706965 7:93860355-93860377 CATGGAGGCCAGAAGAAAGTAGG + Intronic
1031512702 7:122669538-122669560 CATGAGCTCCAGAAGGAAATGGG + Intronic
1031530460 7:122869397-122869419 CCTGAAGACCAGAAGTAAATGGG + Intronic
1032238080 7:130141516-130141538 CATGGAGGCCGGACGGAACTGGG + Intergenic
1032446624 7:131989804-131989826 CATGAAGGGCAGAAGGCACAAGG - Intergenic
1037052447 8:14393337-14393359 GATGAATGCCAGCAGGAACTAGG + Intronic
1037161783 8:15781546-15781568 CTTGCAGGCCAGAAGGAAGTGGG + Intergenic
1037280178 8:17232233-17232255 AATGTAGTTCAGAAGGAACTGGG - Intronic
1037953247 8:23033032-23033054 CATAGAGCCCAGAAGGGAGTGGG + Intronic
1038208255 8:25490048-25490070 CATTAAATCCGGAAGGAACTAGG + Intronic
1038654315 8:29435190-29435212 CATGAAGGCAAGAATGAACTAGG + Intergenic
1038744373 8:30244329-30244351 CATGGAGACCAGAAGGCACTGGG + Intergenic
1039435307 8:37555957-37555979 CATCAATCCCAGCAGGAGCTGGG + Intergenic
1039824201 8:41159069-41159091 CATGTACCACAGAAGGAGCTAGG + Intergenic
1040059310 8:43091007-43091029 CATGAACCCCAGAAGAAGATCGG - Intergenic
1040462826 8:47665263-47665285 AATGGAGGCCAGAAGGCACTGGG + Intronic
1041794181 8:61728987-61729009 AATGAAGACCAGTAGGACCTTGG - Intergenic
1044130450 8:88517224-88517246 CTTGAAGCTCAGAAGAAAATAGG - Intergenic
1046673922 8:117088141-117088163 CAGAAAGCCAAGAAAGAACTTGG + Intronic
1047161667 8:122387333-122387355 CATGAAGCCTATGATGAACTGGG + Intergenic
1048168852 8:132086133-132086155 CATGAAGAAAAGAAGGAAGTGGG + Intronic
1048195311 8:132327670-132327692 CATGGAGCCCAGCAGGTACTTGG - Intronic
1048204169 8:132402230-132402252 CATTAAGCCAAGAAGGAAGTTGG - Intronic
1048490669 8:134890134-134890156 TATGAAGGCCCGAAGGAAGTAGG - Intergenic
1048645428 8:136414325-136414347 CATGCAGGCCATAAGCAACTGGG - Intergenic
1049296138 8:141840483-141840505 GATGGTGCCCAGAAGGATCTGGG - Intergenic
1050342041 9:4650068-4650090 CATGAAGCCAACAAGGCAATTGG - Intronic
1050613618 9:7379090-7379112 CGTGAAGCCAAAAAGGAATTTGG + Intergenic
1051213377 9:14769737-14769759 CATGGACCCCACAGGGAACTCGG - Exonic
1051587376 9:18740817-18740839 CATGAAGCCTTCAGGGAACTGGG - Intronic
1051817095 9:21121074-21121096 CTTGGAACCCAGGAGGAACTAGG - Intergenic
1053249025 9:36559085-36559107 CATGGAGCCCAGAGGGAAAAAGG - Intergenic
1053442047 9:38124716-38124738 CATGAAACACAGAAGAACCTTGG - Intergenic
1055295380 9:74827811-74827833 AATGAAGCTCAGAAGGAACCTGG - Exonic
1055327293 9:75144121-75144143 CATGAAGTCCTGAAGGTCCTGGG + Intronic
1056394510 9:86169174-86169196 CAATAAGCCCAAAAGGAGCTAGG + Intergenic
1057125665 9:92614143-92614165 CTTGCAGCCCTGAAGGACCTAGG + Exonic
1058525660 9:105855569-105855591 TATGAAGCTTAGAGGGAACTGGG - Intergenic
1058593770 9:106593069-106593091 CATGAAGACCAAAAGGAATAAGG + Intergenic
1059095401 9:111408002-111408024 CAACAAGCCGAGAAGGAAGTAGG + Intronic
1060438724 9:123618487-123618509 CATGGAGGCCAGCAGAAACTAGG + Intronic
1061221914 9:129257140-129257162 CCTGGAGGCCAGAAGGAGCTTGG - Intergenic
1061228808 9:129300059-129300081 CATGGTGCCCAGAAGTAAGTGGG - Intergenic
1061344084 9:130008054-130008076 CATGACGCCCAGCAGAAATTAGG - Intronic
1186915350 X:14213239-14213261 CATCAAGCACAGTAGGAAATAGG - Intergenic
1187132755 X:16518313-16518335 CCTGAAGCCAACATGGAACTGGG - Intergenic
1187193917 X:17063037-17063059 GATGATCCCCAGAAGGAACTTGG + Intronic
1187830345 X:23374641-23374663 GATGAAACCCAGAAGGAAAACGG - Intronic
1188549597 X:31348582-31348604 CATGAAGCCCACAGGGACTTTGG - Exonic
1189189300 X:39084118-39084140 CTTGGAGGCCAGAAGGAAGTGGG + Intergenic
1189448791 X:41107357-41107379 CTTGAAGGCCAGAAGGCAGTGGG - Intronic
1189759383 X:44305765-44305787 CATGATGCCAACAAGGACCTAGG + Intronic
1190323010 X:49189257-49189279 AGTGAAGCCCAGGAGGACCTGGG - Exonic
1190990559 X:55545389-55545411 CATGGAGGCCAGAAGGCAGTGGG - Intergenic
1192569363 X:72190118-72190140 CATGAAGCCTAGGAGAAAGTGGG - Intronic
1193748288 X:85310906-85310928 CATGAAGCCCAGAAGGAACTAGG + Intronic
1197494124 X:127155850-127155872 TTTGAAGACCAGAAGGAAGTGGG - Intergenic
1199338275 X:146644666-146644688 CATGAAGACAAGCAGTAACTGGG - Intergenic
1199688303 X:150284355-150284377 CATGGAGGCCAGAAGGTAGTGGG + Intergenic
1201056145 Y:9994207-9994229 CCTTAAGCTGAGAAGGAACTGGG - Intergenic
1202189944 Y:22231372-22231394 CATTAAGCTGAGAAGGAACTGGG + Intergenic