ID: 1193757936

View in Genome Browser
Species Human (GRCh38)
Location X:85431609-85431631
Sequence CCAGAGGTATGGTTGGAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193757930_1193757936 17 Left 1193757930 X:85431569-85431591 CCTTGAAGGTAGCAGCTATGTCT No data
Right 1193757936 X:85431609-85431631 CCAGAGGTATGGTTGGAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193757936 Original CRISPR CCAGAGGTATGGTTGGAAGT AGG Intergenic
No off target data available for this crispr