ID: 1193758633

View in Genome Browser
Species Human (GRCh38)
Location X:85439252-85439274
Sequence GATCTTCAGATGTTCCAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193758633_1193758635 -10 Left 1193758633 X:85439252-85439274 CCACCTTGGAACATCTGAAGATC No data
Right 1193758635 X:85439265-85439287 TCTGAAGATCATGTGTCTTGTGG No data
1193758633_1193758636 -6 Left 1193758633 X:85439252-85439274 CCACCTTGGAACATCTGAAGATC No data
Right 1193758636 X:85439269-85439291 AAGATCATGTGTCTTGTGGATGG No data
1193758633_1193758637 4 Left 1193758633 X:85439252-85439274 CCACCTTGGAACATCTGAAGATC No data
Right 1193758637 X:85439279-85439301 GTCTTGTGGATGGTCATCTCAGG No data
1193758633_1193758638 5 Left 1193758633 X:85439252-85439274 CCACCTTGGAACATCTGAAGATC No data
Right 1193758638 X:85439280-85439302 TCTTGTGGATGGTCATCTCAGGG No data
1193758633_1193758639 18 Left 1193758633 X:85439252-85439274 CCACCTTGGAACATCTGAAGATC No data
Right 1193758639 X:85439293-85439315 CATCTCAGGGAGTGTCTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193758633 Original CRISPR GATCTTCAGATGTTCCAAGG TGG (reversed) Intergenic
No off target data available for this crispr