ID: 1193758634

View in Genome Browser
Species Human (GRCh38)
Location X:85439255-85439277
Sequence CATGATCTTCAGATGTTCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193758634_1193758639 15 Left 1193758634 X:85439255-85439277 CCTTGGAACATCTGAAGATCATG No data
Right 1193758639 X:85439293-85439315 CATCTCAGGGAGTGTCTTACTGG No data
1193758634_1193758637 1 Left 1193758634 X:85439255-85439277 CCTTGGAACATCTGAAGATCATG No data
Right 1193758637 X:85439279-85439301 GTCTTGTGGATGGTCATCTCAGG No data
1193758634_1193758636 -9 Left 1193758634 X:85439255-85439277 CCTTGGAACATCTGAAGATCATG No data
Right 1193758636 X:85439269-85439291 AAGATCATGTGTCTTGTGGATGG No data
1193758634_1193758638 2 Left 1193758634 X:85439255-85439277 CCTTGGAACATCTGAAGATCATG No data
Right 1193758638 X:85439280-85439302 TCTTGTGGATGGTCATCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193758634 Original CRISPR CATGATCTTCAGATGTTCCA AGG (reversed) Intergenic
No off target data available for this crispr