ID: 1193758638

View in Genome Browser
Species Human (GRCh38)
Location X:85439280-85439302
Sequence TCTTGTGGATGGTCATCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193758632_1193758638 6 Left 1193758632 X:85439251-85439273 CCCACCTTGGAACATCTGAAGAT No data
Right 1193758638 X:85439280-85439302 TCTTGTGGATGGTCATCTCAGGG No data
1193758634_1193758638 2 Left 1193758634 X:85439255-85439277 CCTTGGAACATCTGAAGATCATG No data
Right 1193758638 X:85439280-85439302 TCTTGTGGATGGTCATCTCAGGG No data
1193758633_1193758638 5 Left 1193758633 X:85439252-85439274 CCACCTTGGAACATCTGAAGATC No data
Right 1193758638 X:85439280-85439302 TCTTGTGGATGGTCATCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193758638 Original CRISPR TCTTGTGGATGGTCATCTCA GGG Intergenic
No off target data available for this crispr