ID: 1193760779

View in Genome Browser
Species Human (GRCh38)
Location X:85462822-85462844
Sequence ACTTCAGTCAGATAGGACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193760779_1193760786 29 Left 1193760779 X:85462822-85462844 CCACTGTCCTATCTGACTGAAGT No data
Right 1193760786 X:85462874-85462896 TAGTGTGGCAGTACTCCCCATGG No data
1193760779_1193760783 -6 Left 1193760779 X:85462822-85462844 CCACTGTCCTATCTGACTGAAGT No data
Right 1193760783 X:85462839-85462861 TGAAGTGCACTTGGGCCTCAAGG No data
1193760779_1193760787 30 Left 1193760779 X:85462822-85462844 CCACTGTCCTATCTGACTGAAGT No data
Right 1193760787 X:85462875-85462897 AGTGTGGCAGTACTCCCCATGGG No data
1193760779_1193760785 14 Left 1193760779 X:85462822-85462844 CCACTGTCCTATCTGACTGAAGT No data
Right 1193760785 X:85462859-85462881 AGGAAACATCAGAAGTAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193760779 Original CRISPR ACTTCAGTCAGATAGGACAG TGG (reversed) Intergenic
No off target data available for this crispr