ID: 1193760780

View in Genome Browser
Species Human (GRCh38)
Location X:85462829-85462851
Sequence CAAGTGCACTTCAGTCAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193760780_1193760785 7 Left 1193760780 X:85462829-85462851 CCTATCTGACTGAAGTGCACTTG No data
Right 1193760785 X:85462859-85462881 AGGAAACATCAGAAGTAGTGTGG No data
1193760780_1193760787 23 Left 1193760780 X:85462829-85462851 CCTATCTGACTGAAGTGCACTTG No data
Right 1193760787 X:85462875-85462897 AGTGTGGCAGTACTCCCCATGGG No data
1193760780_1193760788 30 Left 1193760780 X:85462829-85462851 CCTATCTGACTGAAGTGCACTTG No data
Right 1193760788 X:85462882-85462904 CAGTACTCCCCATGGGCCTGTGG 0: 15
1: 58
2: 149
3: 253
4: 476
1193760780_1193760786 22 Left 1193760780 X:85462829-85462851 CCTATCTGACTGAAGTGCACTTG No data
Right 1193760786 X:85462874-85462896 TAGTGTGGCAGTACTCCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193760780 Original CRISPR CAAGTGCACTTCAGTCAGAT AGG (reversed) Intergenic
No off target data available for this crispr