ID: 1193760785 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:85462859-85462881 |
| Sequence | AGGAAACATCAGAAGTAGTG TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1193760780_1193760785 | 7 | Left | 1193760780 | X:85462829-85462851 | CCTATCTGACTGAAGTGCACTTG | No data | ||
| Right | 1193760785 | X:85462859-85462881 | AGGAAACATCAGAAGTAGTGTGG | No data | ||||
| 1193760779_1193760785 | 14 | Left | 1193760779 | X:85462822-85462844 | CCACTGTCCTATCTGACTGAAGT | No data | ||
| Right | 1193760785 | X:85462859-85462881 | AGGAAACATCAGAAGTAGTGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1193760785 | Original CRISPR | AGGAAACATCAGAAGTAGTG TGG | Intergenic | ||
| No off target data available for this crispr | |||||