ID: 1193760785

View in Genome Browser
Species Human (GRCh38)
Location X:85462859-85462881
Sequence AGGAAACATCAGAAGTAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193760780_1193760785 7 Left 1193760780 X:85462829-85462851 CCTATCTGACTGAAGTGCACTTG No data
Right 1193760785 X:85462859-85462881 AGGAAACATCAGAAGTAGTGTGG No data
1193760779_1193760785 14 Left 1193760779 X:85462822-85462844 CCACTGTCCTATCTGACTGAAGT No data
Right 1193760785 X:85462859-85462881 AGGAAACATCAGAAGTAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193760785 Original CRISPR AGGAAACATCAGAAGTAGTG TGG Intergenic
No off target data available for this crispr