ID: 1193772889

View in Genome Browser
Species Human (GRCh38)
Location X:85608636-85608658
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193772886_1193772889 19 Left 1193772886 X:85608594-85608616 CCAGATAGAGAAGGAAGTGAATG No data
Right 1193772889 X:85608636-85608658 AGTGACCCACGTCCAGGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193772889 Original CRISPR AGTGACCCACGTCCAGGGAA AGG Intergenic
No off target data available for this crispr