ID: 1193776118

View in Genome Browser
Species Human (GRCh38)
Location X:85643923-85643945
Sequence TCCCTTAAGGAGCTCTTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193776118_1193776120 -10 Left 1193776118 X:85643923-85643945 CCTTGCAAGAGCTCCTTAAGGGA No data
Right 1193776120 X:85643936-85643958 CCTTAAGGGAGTTCCACATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193776118 Original CRISPR TCCCTTAAGGAGCTCTTGCA AGG (reversed) Intergenic
No off target data available for this crispr