ID: 1193780119

View in Genome Browser
Species Human (GRCh38)
Location X:85691112-85691134
Sequence CAGACTGAACACAAGCATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193780119_1193780123 29 Left 1193780119 X:85691112-85691134 CCTCCATGCTTGTGTTCAGTCTG No data
Right 1193780123 X:85691164-85691186 ATAACACCAACAAATATTGGTGG No data
1193780119_1193780124 30 Left 1193780119 X:85691112-85691134 CCTCCATGCTTGTGTTCAGTCTG No data
Right 1193780124 X:85691165-85691187 TAACACCAACAAATATTGGTGGG No data
1193780119_1193780122 26 Left 1193780119 X:85691112-85691134 CCTCCATGCTTGTGTTCAGTCTG No data
Right 1193780122 X:85691161-85691183 GAAATAACACCAACAAATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193780119 Original CRISPR CAGACTGAACACAAGCATGG AGG (reversed) Intergenic
No off target data available for this crispr