ID: 1193780120

View in Genome Browser
Species Human (GRCh38)
Location X:85691115-85691137
Sequence CTTCAGACTGAACACAAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193780120_1193780124 27 Left 1193780120 X:85691115-85691137 CCATGCTTGTGTTCAGTCTGAAG No data
Right 1193780124 X:85691165-85691187 TAACACCAACAAATATTGGTGGG No data
1193780120_1193780123 26 Left 1193780120 X:85691115-85691137 CCATGCTTGTGTTCAGTCTGAAG No data
Right 1193780123 X:85691164-85691186 ATAACACCAACAAATATTGGTGG No data
1193780120_1193780125 28 Left 1193780120 X:85691115-85691137 CCATGCTTGTGTTCAGTCTGAAG No data
Right 1193780125 X:85691166-85691188 AACACCAACAAATATTGGTGGGG No data
1193780120_1193780122 23 Left 1193780120 X:85691115-85691137 CCATGCTTGTGTTCAGTCTGAAG No data
Right 1193780122 X:85691161-85691183 GAAATAACACCAACAAATATTGG No data
1193780120_1193780126 29 Left 1193780120 X:85691115-85691137 CCATGCTTGTGTTCAGTCTGAAG No data
Right 1193780126 X:85691167-85691189 ACACCAACAAATATTGGTGGGGG No data
1193780120_1193780127 30 Left 1193780120 X:85691115-85691137 CCATGCTTGTGTTCAGTCTGAAG No data
Right 1193780127 X:85691168-85691190 CACCAACAAATATTGGTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193780120 Original CRISPR CTTCAGACTGAACACAAGCA TGG (reversed) Intergenic
No off target data available for this crispr