ID: 1193780122

View in Genome Browser
Species Human (GRCh38)
Location X:85691161-85691183
Sequence GAAATAACACCAACAAATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193780120_1193780122 23 Left 1193780120 X:85691115-85691137 CCATGCTTGTGTTCAGTCTGAAG No data
Right 1193780122 X:85691161-85691183 GAAATAACACCAACAAATATTGG No data
1193780119_1193780122 26 Left 1193780119 X:85691112-85691134 CCTCCATGCTTGTGTTCAGTCTG No data
Right 1193780122 X:85691161-85691183 GAAATAACACCAACAAATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193780122 Original CRISPR GAAATAACACCAACAAATAT TGG Intergenic
No off target data available for this crispr